View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13653_low_15 (Length: 312)
Name: NF13653_low_15
Description: NF13653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13653_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 299
Target Start/End: Original strand, 13792969 - 13793251
Alignment:
| Q |
17 |
ctattagagagagattggtcgttgatttgaaggactgatttgacggtttctgtggaggacataactatggtagttattcggcccaattttaaggacatta |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13792969 |
ctattagagagagaatggtcgttgatttgaaggactgatttgacagtttctgtggaggacataactatggtagttattcggcccaattttaaggacatta |
13793068 |
T |
 |
| Q |
117 |
ttgggccgtggattttggagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793069 |
ttgggccgtggattttggagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtgg |
13793168 |
T |
 |
| Q |
217 |
aagtcgaggtttgtgttttatgagaaaggaatagaggatttggaggaagatgaagatgaagagaatgaggagtgtggtgttga |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13793169 |
aagtcgaggtttgtgttttatgagaaaggaatagaggatttggaggaagatgaagatgaagagaatgaggagtgtagtgttga |
13793251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University