View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13653_low_16 (Length: 304)
Name: NF13653_low_16
Description: NF13653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13653_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 47170642 - 47170914
Alignment:
| Q |
18 |
ggtaccaagagaagatgtggtgctgtatctggtgtttccaccgtgaaaaatccaatctctcttgctcgtcttgtcatggagaaatcccctcattcctacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47170642 |
ggtaccaagagaagatgtggtgctgtatctggtgtttccaccgtgaaaaatccaatctctcttgctcgtcttgtcatggaaaaatcccctcattcctacc |
47170741 |
T |
|
| Q |
118 |
tcgcctacaccggtgcagaagaatttgctagggaacaggttcatatcattacttctcttttttattccaatttttgatgcataaatatatttgtttttaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47170742 |
tcgcctacaccggtgcagaagaatttgctagggaacaggttcatatcattacttctcttttttattcaaatttttgatgcataaatatatttgtttttaa |
47170841 |
T |
|
| Q |
218 |
tcaaaagaaatttggtcatgttttttctagggcgtggagactgaggacaatgaatatttcatcactcctgata |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170842 |
tcaaaagaaatttggtcatgttttttctagggcgtggagactgaggacaatgaatatttcatcactcctgata |
47170914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 159
Target Start/End: Complemental strand, 42163712 - 42163571
Alignment:
| Q |
18 |
ggtaccaagagaagatgtggtgctgtatctggtgtttccaccgtgaaaaatccaatctctcttgctcgtcttgtcatggagaaatcccctcattcctacc |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||| || |||| |||||||| ||||||||||| || ||||||||||| |||| |
|
|
| T |
42163712 |
ggtacaaagagaagatgtggtgctgtatctggtgttaccaccgtgaaaaaccctgtctcacttgctcgccttgtcatggaaaagtcccctcattcatacc |
42163613 |
T |
|
| Q |
118 |
tcgcctacaccggtgcagaagaatttgctagggaacaggttc |
159 |
Q |
| |
|
| | || | | || |||||||||||||| ||||| ||||||| |
|
|
| T |
42163612 |
taggcttctctggggcagaagaatttgcgagggaccaggttc |
42163571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 290
Target Start/End: Complemental strand, 42163378 - 42163324
Alignment:
| Q |
236 |
tgttttttctagggcgtggagactgaggacaatgaatatttcatcactcctgata |
290 |
Q |
| |
|
||||||| |||||| ||||| | |||||| |||||||| |||||||||||||||| |
|
|
| T |
42163378 |
tgtttttgctagggtgtggatattgaggataatgaatacttcatcactcctgata |
42163324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 63 - 159
Target Start/End: Complemental strand, 5480633 - 5480537
Alignment:
| Q |
63 |
aaaaatccaatctctcttgctcgtcttgtcatggagaaatcccctcattcctacctcgcctacaccggtgcagaagaatttgctagggaacaggttc |
159 |
Q |
| |
|
||||||||||| || || |||||| | |||||||| ||||| ||||||||||| || || | | ||| || ||||| ||||||||| ||||||||| |
|
|
| T |
5480633 |
aaaaatccaatttcactggctcgtttagtcatggataaatctcctcattcctatcttgcttttaacggcgctgaagattttgctaggcaacaggttc |
5480537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University