View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13656_low_10 (Length: 208)
Name: NF13656_low_10
Description: NF13656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13656_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 28826172 - 28826112
Alignment:
| Q |
19 |
gagagattttacggcatgcggttaaaaatgggaaacactgcttcactgcaattatcattac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28826172 |
gagagattttacggcatgcggttaaaaatgggaaacactgcttcactgcaattatcattac |
28826112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 183
Target Start/End: Complemental strand, 28826042 - 28826008
Alignment:
| Q |
149 |
attccatcaactctgaacaatgaaataatgatggc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28826042 |
attccatcaactctgaacaatgaaataatgatggc |
28826008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University