View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13657_low_3 (Length: 228)
Name: NF13657_low_3
Description: NF13657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13657_low_3 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0082 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 88 - 205
Target Start/End: Original strand, 48563 - 48681
Alignment:
| Q |
88 |
ccctacttcaatggaaagggg-gaatcgccgtttcacagccgctcctctacaactaactacctttcgtccaacatgatcacaaatgaagacagagaattg |
186 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||| |
|
|
| T |
48563 |
ccctacttcaatggaaaggggggaatcgccgtttcacagccgctcctctacaactaactacctttcgcccaacatgatcacgaacgaagacagagaattg |
48662 |
T |
 |
| Q |
187 |
cgtagatagaaggacgaaa |
205 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48663 |
cgtagatagaaggacgaaa |
48681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University