View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13658_low_6 (Length: 240)
Name: NF13658_low_6
Description: NF13658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13658_low_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 2447142 - 2446922
Alignment:
| Q |
20 |
cgctattcagtaaactgagccatatatatccgacaaaagcaaagtccaagctttccagcagaaatcatacttgagttgatcagtcatcttatgccaagtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447142 |
cgctattcagtaaactgagccatatatatccgacaaaagcaaactccaagctttccagcataaatcatacttgagttgatcagtcatcttatgccaagtt |
2447043 |
T |
|
| Q |
120 |
atatatcaataaactaaccccattcagattcaatcaatgattaaattaagaaacatatttgtcataccataagactccaattaaatttccttaattccat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447042 |
atatatcaataaactaaccccattcagattcaatcaatgattaaattatgaaacatatttgtcataccataagactccaattaaatttccttaattccat |
2446943 |
T |
|
| Q |
220 |
gataaattgtgttacttacac |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2446942 |
gataaattgtgttacttacac |
2446922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University