View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_high_18 (Length: 367)
Name: NF1365_high_18
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 8 - 289
Target Start/End: Original strand, 52179718 - 52179999
Alignment:
| Q |
8 |
ccaagaatattacacaatgtcacaaacacattcaatgctcgagtttacaaaggagaatcttaactattggctactagatcacccatcaattgtttcattc |
107 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52179718 |
ccaagaaaattacacaatgtcacaaacatattcaatgctcgagtttacaaaggagaatcttaactattggctactagatcacccatcaattgtttcattc |
52179817 |
T |
 |
| Q |
108 |
cggtggagtcctgccctatcatggggagccacatggtggtttctcatctccgccatattcttttacatctccatcacggtaactatccacgtcatcctta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52179818 |
cggtggagtcctgccctatcatggggagccacatggtggtttctcatctccgccatattcttttacatctccatcacggtaactatccacgtcatcctta |
52179917 |
T |
 |
| Q |
208 |
aactatgtcggagactgcgccctgtacctttaggtccattcccagcaattcataatctctccatgtcattgatctccctaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
52179918 |
aactatgtcggagactgcgccctgtacctttaggtccattaccagcaattcatagtctctccatgtcattaatctccctaac |
52179999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University