View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_high_26 (Length: 251)
Name: NF1365_high_26
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_high_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 171 - 250
Target Start/End: Complemental strand, 30210386 - 30210307
Alignment:
| Q |
171 |
ttattattaactttttacatgatttatctattttcaatgtgatgagtttcaccccaaaaatatacctcaactcaatactc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30210386 |
ttattattaactttttacatgatttatctattttcaatgtgatgagtttcaccccaacaatatacctcaactcaatactc |
30210307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 86 - 149
Target Start/End: Complemental strand, 30211427 - 30211364
Alignment:
| Q |
86 |
ttggaagagtttgatgtaaattaaaatttttaagcagatctaattcaaccttacaaaacaacat |
149 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30211427 |
ttggaagagtttgatgtaaattaaaaattttaagcagatctaattcaaccttacaaaacaacat |
30211364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University