View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_high_31 (Length: 227)
Name: NF1365_high_31
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_high_31 |
 |  |
|
| [»] scaffold0164 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 185
Target Start/End: Original strand, 29417073 - 29417154
Alignment:
| Q |
104 |
tttcttcctatactctacaaaaattgtaagctttaagttcaaacaaatactacattctagggtttagggtaatatatacttg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29417073 |
tttcttcctatactctacaaaaattgtaagctttaagttcaaacaaatactacattctagggtttagggttatatatacttg |
29417154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 893242 - 893173
Alignment:
| Q |
1 |
ttcttatcttttactattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgttc |
70 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893242 |
ttcttatctttgactattcatcttcactcatcacttctctctatgtattttctatgtttgatgattgttc |
893173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 70
Target Start/End: Complemental strand, 12316235 - 12316178
Alignment:
| Q |
13 |
actattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgttc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12316235 |
actattcatcttcactcatgacttctctctatatattttctatgtttgatgattgttc |
12316178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 18566735 - 18566792
Alignment:
| Q |
13 |
actattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgttc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
18566735 |
actattcatcttcactcatgacttctctttatatattttctatgtttgatgattgttc |
18566792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 1724650 - 1724596
Alignment:
| Q |
15 |
tattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgtt |
69 |
Q |
| |
|
||||||| |||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
1724650 |
tattcatattcactcatgacttctctctatatcttctctatgtttgatgattgtt |
1724596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 18809985 - 18810041
Alignment:
| Q |
13 |
actattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgtt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18809985 |
actattcatcttcactcatgacttctctctatatattttctatgtttgatgattgtt |
18810041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 13758349 - 13758295
Alignment:
| Q |
15 |
tattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgtt |
69 |
Q |
| |
|
||||||| |||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
13758349 |
tattcatattcactcatgacttctctctatatcttctctatgtttgatgattgtt |
13758295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 17228 - 17282
Alignment:
| Q |
16 |
attcatcttcactcatgacttctctctatgtattttctatgtttgatgattgttc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17228 |
attcatcttcactcatgacttctctctatatattttctatgtttgatgattgttc |
17282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 24072768 - 24072822
Alignment:
| Q |
16 |
attcatcttcactcatgacttctctctatgtattttctatgtttgatgattgttc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24072768 |
attcatcttcactcatgacttctctctatatattttctatgtttgatgattgttc |
24072822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 66
Target Start/End: Complemental strand, 44482477 - 44482424
Alignment:
| Q |
13 |
actattcatcttcactcatgacttctctctatgtattttctatgtttgatgatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
44482477 |
actattcatcttcactcatgacttctctctatatattttctatttttgatgatt |
44482424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 19834654 - 19834706
Alignment:
| Q |
18 |
tcatcttcactcatgacttctctctatgtattttctatgtttgatgattgttc |
70 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19834654 |
tcatcttcactcatgacttctctctatatattttctatgtttgatgattgttc |
19834706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 54078021 - 54077967
Alignment:
| Q |
15 |
tattcatcttcactcatgacttctctctatgtattttctatgtttgatgattgtt |
69 |
Q |
| |
|
||||||| |||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
54078021 |
tattcatattcactcatgacttctctctatatcttctctatgtttgatgattgtt |
54077967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University