View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_high_32 (Length: 210)
Name: NF1365_high_32
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 36 - 163
Target Start/End: Original strand, 4433551 - 4433678
Alignment:
| Q |
36 |
ccaactttctcttttcttacatcagccaccaccctatcatcaatcaccacctccattatcggtcaccaccaccattgtcctccttcatcaccgatcataa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4433551 |
ccaactttctcttttcttacatcagccaccaccctatcatcaatcaccacctccattatcggtcaccaccaccattgtcctccttcatcaccgatcataa |
4433650 |
T |
 |
| Q |
136 |
caccattatcctcatccttctccctatg |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
4433651 |
caccattatcctcatccttctccttatg |
4433678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University