View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1365_high_33 (Length: 204)

Name: NF1365_high_33
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1365_high_33
NF1365_high_33
[»] chr6 (1 HSPs)
chr6 (77-204)||(3712359-3712484)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 77 - 204
Target Start/End: Complemental strand, 3712484 - 3712359
Alignment:
77 gaagaatatccaggaaatgaaaattgctagttatgccagcaaaataaaaacatataaatattttattggcaaaattgcnnnnnnnnnnnaaaaaccaaaa 176  Q
    |||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||             |||||||||    
3712484 gaagaaaatccaggaaatgaaaattgctagccatgccagcaaaataaaaacatataaatattttattggcaaaattgcatttttttttt--aaaccaaaa 3712387  T
177 tgagtaatagtcaattttgtttctgaat 204  Q
    ||||||||||||||||||||||||||||    
3712386 tgagtaatagtcaattttgtttctgaat 3712359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University