View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_low_26 (Length: 292)
Name: NF1365_low_26
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 79 - 184
Target Start/End: Original strand, 47140173 - 47140278
Alignment:
| Q |
79 |
atacttttatttacattccttgtattatgattactttgtttctgtataaaaaatcgtttttaggaaatactgcaatgttaatttataaacttcaggttca |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47140173 |
atacttttatttacattccttgtattatgattactttgtttctgtataaaaaatcgttttaaggaaataatgcaatgttaatttataaacttcaggttca |
47140272 |
T |
 |
| Q |
179 |
agatgt |
184 |
Q |
| |
|
|||||| |
|
|
| T |
47140273 |
agatgt |
47140278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 213 - 281
Target Start/End: Original strand, 47140299 - 47140367
Alignment:
| Q |
213 |
ttaggtcatactcatacagaatgcaataagaccaataaaggatggatacgatctgtagaaagctttcat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47140299 |
ttaggtcatactcatacagaatgcaataagaccaataaaggatggatacgatctgtagaaagctttcat |
47140367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 47140082 - 47140133
Alignment:
| Q |
30 |
agtgcaattctaattacttatagaataagtttcatccgatcgtaagttaata |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47140082 |
agtgcaattctaattacttatagaataagtttcatccgatcgtaagataata |
47140133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University