View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_low_28 (Length: 262)
Name: NF1365_low_28
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_low_28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 65 - 262
Target Start/End: Complemental strand, 36664539 - 36664338
Alignment:
| Q |
65 |
attaaacagaaattatatactccatcgaatcacactttagatgtttaatcccctttaagaaggag-gtgttaaagagactcaagtaaactaattttatac |
163 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
36664539 |
attaaatagaaattatatactccatcgaa-cacactttagatgtttaatcccctttaagaaggagcgtgttaaagagactcgagtaaactagttttatac |
36664441 |
T |
|
| Q |
164 |
aaatgttcaataaaaataaattacgtggtaataaacgtaattaagaatatgatgggtt----ttcaatgcatatttataaaactattttacatcgtcatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
36664440 |
aaatgttcaataaaaataaattacgtggtaataaacgtaattaagattatgatggattttcgttcaatggatatttataaaactattttacatcgtcaat |
36664341 |
T |
|
| Q |
260 |
gtg |
262 |
Q |
| |
|
||| |
|
|
| T |
36664340 |
gtg |
36664338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University