View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_low_40 (Length: 208)
Name: NF1365_low_40
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 54020179 - 54020068
Alignment:
| Q |
1 |
atttctctaacccacccgaacnnnnnnnnctgtctccactccatcaccgtttcttttctttttggatttacaccaattggcaaactaagctatcgtagtg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54020179 |
atttctctaacccacccgaacttttttttctgtctccactccaccactgtttcttttcttcttggatttacactaattggcaaactaagctatcgtagtg |
54020080 |
T |
 |
| Q |
101 |
gtatggatgtta |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54020079 |
gtatggatgtta |
54020068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University