View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_low_41 (Length: 204)
Name: NF1365_low_41
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_low_41 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 77 - 204
Target Start/End: Complemental strand, 3712484 - 3712359
Alignment:
| Q |
77 |
gaagaatatccaggaaatgaaaattgctagttatgccagcaaaataaaaacatataaatattttattggcaaaattgcnnnnnnnnnnnaaaaaccaaaa |
176 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3712484 |
gaagaaaatccaggaaatgaaaattgctagccatgccagcaaaataaaaacatataaatattttattggcaaaattgcatttttttttt--aaaccaaaa |
3712387 |
T |
 |
| Q |
177 |
tgagtaatagtcaattttgtttctgaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3712386 |
tgagtaatagtcaattttgtttctgaat |
3712359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University