View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1365_low_44 (Length: 203)
Name: NF1365_low_44
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1365_low_44 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 84 - 203
Target Start/End: Complemental strand, 3712477 - 3712359
Alignment:
| Q |
84 |
atccaggaaatgaaaattgctagttatgccagcaaaataaaaacatataaatattttattggcaaaattgcnnnnnnnnnnaaaaaccaaaatgagtaat |
183 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3712477 |
atccaggaaatgaaaattgctagccatgccagcaaaataaaaacatataaatattttattggcaaaattgcattttttttt-taaaccaaaatgagtaat |
3712379 |
T |
|
| Q |
184 |
agtcaattttgtttctgaat |
203 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3712378 |
agtcaattttgtttctgaat |
3712359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University