View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13660_low_14 (Length: 308)
Name: NF13660_low_14
Description: NF13660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13660_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 12 - 291
Target Start/End: Original strand, 50420535 - 50420814
Alignment:
| Q |
12 |
catcatcatagatctataacttttctgtcttttctttatggcttcatatctcacttttccacccatgttgatgatgtgaaaaatatcctttttgccggtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50420535 |
catcatcatagatctataacttttctgtcttttctttatggcttcatatctcacttttccacccatgtcgatgatgtgaaaaatatcctttttgccggtg |
50420634 |
T |
 |
| Q |
112 |
aaaatacagtactgacaaatttttattgcacttctaggtttaaaatgttcaggttcagggtttctagagtatgacatttatcaaactaccctaagaaaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50420635 |
aaaatacagtactgacaaatttttattgcacttctaggtttaacatgttcaggttcagggtttctagagtatggcatttatcaaactaccctaagaaaaa |
50420734 |
T |
 |
| Q |
212 |
acaattttatggtatacccaagtatcctctactcgaaattgtagagactaatgatcccttgagtcgacaaagactacaat |
291 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50420735 |
acaattttttggtatacccaagtatcctctactggaaattgtagagactaatgatcccttgagtcgacaaagactacaat |
50420814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University