View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13662_high_6 (Length: 284)
Name: NF13662_high_6
Description: NF13662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13662_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 27671070 - 27671297
Alignment:
| Q |
7 |
aataaaacacagtttgcttatctacgttacatcatatatctatctttcatcaaatggttgcacgagtacgatatgctagtttatttaaaaattgaggaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27671070 |
aataaaacacagtttgcttatctacgttacatcatatatctatctttcatcaactggttgcaggagtacgatatgctagtttatttaaaaattgaggaag |
27671169 |
T |
 |
| Q |
107 |
atgatattaagaatcatggttccaacctgaagagaattgactagtacaagacttgagagactcaaggctgagccacttgcaattgagtgaatttacattc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27671170 |
atgatattaagaatcatggttccaacctgaagagaattgactagtacaagacttgagagactcaaggctgagccacttgcaattgagtgaatttacattc |
27671269 |
T |
 |
| Q |
207 |
aatatcccttctaggacttttgggagta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27671270 |
aatatcccttctaggacttttgggagta |
27671297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 241 - 281
Target Start/End: Complemental strand, 27671348 - 27671308
Alignment:
| Q |
241 |
gtgacagtcttgatgacgagagcttcaaaaatcatttacct |
281 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27671348 |
gtgacagtcttgaggacgagagcttcaaaaatcatttacct |
27671308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University