View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13663_high_2 (Length: 399)
Name: NF13663_high_2
Description: NF13663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13663_high_2 |
 |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 126)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 21 - 182
Target Start/End: Complemental strand, 6182656 - 6182497
Alignment:
| Q |
21 |
acatccatctacatcaaatcaaacccaacaatctttcagcgtgtttgcaaagttcactaacatagtcaatatagttggtaaaataaagttggagagagag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |||| | |||||||||||||||||||||||| ||| |
|
|
| T |
6182656 |
acatccatctacatcaaatcaaacccaacaatcttttagggcgtttgcaaagttcactaacattgtcagtgtagttggtaaaataaagttggaga--gag |
6182559 |
T |
 |
| Q |
121 |
atgaagttgttgggttaaatttggtatagatggactatagtaagattttgtggaaaagttta |
182 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6182558 |
atgaagttgtggggttaaatttggtatagatggactctagtaagattttgtggaaaagttta |
6182497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 383
Target Start/End: Complemental strand, 6181313 - 6181252
Alignment:
| Q |
322 |
ggtttatttctcttatttggtgcaaaagcattgtcattattttatatcacagatttttcttc |
383 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6181313 |
ggtttatttctcttattagatgcaaaagcattgtcattattttatatcacagatttttcttc |
6181252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 25431857 - 25431803
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25431857 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
25431803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30928680 - 30928732
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
30928732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 6412214 - 6412269
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6412214 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
6412269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 12176647 - 12176592
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12176647 |
tttaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
12176592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 12757609 - 12757664
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcact |
12757664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 22543722 - 22543667
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
22543722 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
22543667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 8170153 - 8170099
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtca |
8170099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 23770162 - 23770212
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
23770212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 317808 - 317861
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
317808 |
tttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 7156162 - 7156109
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7156109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 10910966 - 10910913
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10910966 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
10910913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 23502541 - 23502492
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 24692981 - 24692928
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtc |
24692928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3276355 - 3276303
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3276303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3968644 - 3968696
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3968696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9896638 - 9896586
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
9896586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11448536 - 11448588
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
11448588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15076205 - 15076153
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
15076153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19690392 - 19690444
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19690444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21385250 - 21385302
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
21385302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24274132 - 24274080
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
24274080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33801744 - 33801692
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
33801692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 494405 - 494456
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
494456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1890456 - 1890401
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
1890456 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
1890401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 15962023 - 15962078
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
15962023 |
tttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
15962078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 15962389 - 15962338
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
15962338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 21994407 - 21994352
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
21994407 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
21994352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34582529 - 34582580
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
34582580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 1214999 - 1214945
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1214999 |
ttaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtc |
1214945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 14655376 - 14655430
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14655376 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
14655430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 18024378 - 18024324
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
18024378 |
ttaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc |
18024324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 19321135 - 19321081
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
19321135 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 31166871 - 31166921
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
31166921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 34582895 - 34582841
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
34582895 |
ttaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
34582841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 318099 - 318046
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
318099 |
taggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtc |
318046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 1007511 - 1007458
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1007511 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1007458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 2615870 - 2615923
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
2615923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 3414385 - 3414438
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3414438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3969011 - 3968958
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3969011 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3968958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 8680773 - 8680826
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8680773 |
taggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtc |
8680826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12419706 - 12419759
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
12419706 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
12419759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 12419940 - 12419887
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
12419940 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
12419887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21993785 - 21993838
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
21993785 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtc |
21993838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22543352 - 22543405
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22543352 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
22543405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 25137359 - 25137306
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25137359 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25137306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 26375692 - 26375741
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 32885671 - 32885724
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
32885671 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
32885724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3356141 - 3356193
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
3356193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 3356495 - 3356447
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3356447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3414753 - 3414701
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
3414701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7155796 - 7155848
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
7155848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8681117 - 8681065
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
8681065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 10091039 - 10091087
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
10091087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14656261 - 14656209
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
14656209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 20467720 - 20467668
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
20467720 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20467668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21995063 - 21995115
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtc |
21995115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22792900 - 22792848
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtc |
22792848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22822652 - 22822600
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
22822600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25136993 - 25137045
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtc |
25137045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 26376042 - 26375994
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
26375994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31398542 - 31398490
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
31398490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33131851 - 33131799
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtc |
33131799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 543365 - 543412
Alignment:
| Q |
187 |
aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
543412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 1007120 - 1007175
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1007120 |
tttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
1007175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 6564947 - 6564893
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| || |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6564947 |
tttaggctaaaattgg-ttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10910629 - 10910680
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtc |
10910680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 12299141 - 12299090
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
12299090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 12612363 - 12612308
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
12612363 |
tttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtc |
12612308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14428646 - 14428701
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
14428646 |
tttaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
14428701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 15116669 - 15116721
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
15116669 |
tttaggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 17771911 - 17771962
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
17771962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 19129524 - 19129469
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
19129524 |
tttaggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtc |
19129469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 24273827 - 24273878
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
24273878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 25121500 - 25121445
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
25121500 |
tttaggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtc |
25121445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30239293 - 30239344
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtc |
30239344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30929044 - 30928993
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
30928993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31167200 - 31167149
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtc |
31167149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 31198615 - 31198666
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
31198666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 5286949 - 5286900
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
5286900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 7324194 - 7324141
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
7324194 |
taggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
7324141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13617531 - 13617580
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
13617580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 15722608 - 15722661
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtc |
15722661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21147402 - 21147455
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
21147402 |
taggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtc |
21147455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 23628799 - 23628852
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
||||||||| |||||| ||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcact |
23628852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 25121182 - 25121234
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
25121182 |
taggctaaaatatggttttcatc-ctgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||| |||||||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2373178 - 2373230
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||| ||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtc |
2373230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6412580 - 6412528
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
6412528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6468309 - 6468361
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtc |
6468361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11449170 - 11449118
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtc |
11449118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 11926035 - 11925983
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
11926035 |
taggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12298825 - 12298873
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtc |
12298873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13150751 - 13150699
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtc |
13150699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 13268108 - 13268160
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtc |
13268160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 21385585 - 21385533
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
21385533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 23770442 - 23770398
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgtttt |
224 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
23770442 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33808619 - 33808671
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||| ||||||||| |||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtc |
33808671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 34990312 - 34990264
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
34990264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 6564595 - 6564633
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
6564633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 31276339 - 31276289
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtc |
31276289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 34989962 - 34990012
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| | |||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtc |
34990012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9896280 - 9896329
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||| |||| ||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtc |
9896329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 13617817 - 13617765
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13617817 |
tttaggctaaaat---gttttggtccctgcaaatatgcctcgttttggttttagtc |
13617765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 14428948 - 14428899
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc |
14428899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19129334 - 19129387
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||| || ||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19129334 |
taggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtc |
19129387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 777676 - 777728
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtc |
777728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1214695 - 1214747
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||| | |||||||||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtc |
1214747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 234
Target Start/End: Original strand, 7323891 - 7323919
Alignment:
| Q |
206 |
tgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7323891 |
tgcaaatatgtctcgttttggttttagtc |
7323919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 17765376 - 17765324
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtc |
17765324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 18024014 - 18024062
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtc |
18024062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19296107 - 19296159
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtc |
19296159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20467354 - 20467402
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtc |
20467402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 184 - 228
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtt |
228 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 24370 - 24423
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24370 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtc |
24423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 2e-19; HSPs: 149)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 24781987 - 24782040
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781987 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtc |
24782040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 36577720 - 36577773
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36577720 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
36577773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26133414 - 26133362
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26133362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 31037745 - 31037693
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31037745 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 5950172 - 5950227
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5950172 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
5950227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14318041 - 14318096
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14318041 |
tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
14318096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 29692740 - 29692795
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29692740 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29692795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 29875729 - 29875674
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29875729 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29875674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 4203773 - 4203719
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
4203773 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
4203719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 5614534 - 5614480
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5614534 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5614480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 18046351 - 18046297
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18046351 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18046297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 29366949 - 29366899
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29366899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3850601 - 3850548
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
3850548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 5917124 - 5917177
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
5917124 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
5917177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 10744056 - 10744003
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
10744003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19685015 - 19685068
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19685015 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19685068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 20690731 - 20690784
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
20690731 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 30800492 - 30800545
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30800492 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
30800545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30800852 - 30800799
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
30800799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 35877056 - 35877003
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
35877056 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
35877003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1381246 - 1381298
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
1381298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2217493 - 2217545
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
2217545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2217855 - 2217803
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
2217803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 233
Target Start/End: Original strand, 4203450 - 4203506
Alignment:
| Q |
177 |
agtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
4203450 |
agttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5614165 - 5614217
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
5614217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7075571 - 7075623
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7075623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10743723 - 10743775
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
10743775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13990896 - 13990844
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
13990844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16038376 - 16038428
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16038428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18046037 - 18046089
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
18046037 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
18046089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 18258528 - 18258476
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
18258476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18633598 - 18633650
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18633650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19565466 - 19565518
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19565518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21124912 - 21124964
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
21124964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 23381948 - 23382000
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
23381948 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
23382000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28863509 - 28863561
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28863561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29172887 - 29172835
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29172835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 35167166 - 35167114
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35167114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 36578084 - 36578032
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
36578032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 38496783 - 38496731
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
38496731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45138 - 45189
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
45189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 175 - 234
Target Start/End: Original strand, 1104850 - 1104909
Alignment:
| Q |
175 |
aaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
1104850 |
aaagtttaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
1104909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1105152 - 1105097
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1105152 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1105097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2032940 - 2032889
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| || |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtc |
2032889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 10409330 - 10409275
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
10409330 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 19565835 - 19565780
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19565835 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
19565780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 28550827 - 28550878
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28550878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 28863838 - 28863787
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28863787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30888160 - 30888211
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
30888211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 33336026 - 33335975
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
33335975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 34125303 - 34125358
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34125303 |
tttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
34125358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35166162 - 35166107
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35166162 |
tttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtc |
35166107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35928458 - 35928407
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35928407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 39379614 - 39379559
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
39379614 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
39379559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40029497 - 40029446
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
40029446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29172524 - 29172574
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29172574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 37271356 - 37271410
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37271356 |
ttaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc |
37271410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 6912855 - 6912806
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
6912806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 24443746 - 24443693
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24443746 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24443693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 27850372 - 27850323
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtc |
27850323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 40029140 - 40029189
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 40168010 - 40167957
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40168010 |
taggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtc |
40167957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 42207240 - 42207293
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtc |
42207293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 293827 - 293879
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
293879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1381612 - 1381560
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1381560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4736543 - 4736491
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
4736491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5917461 - 5917409
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5917409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10408927 - 10408979
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10408979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11799459 - 11799407
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtc |
11799407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15635708 - 15635656
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc |
15635656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19685381 - 19685329
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
19685329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20660947 - 20660999
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
20660999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35928063 - 35928115
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35928115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37271707 - 37271655
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtc |
37271655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38170513 - 38170565
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
38170565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38786158 - 38786210
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
38786210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40167785 - 40167837
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtc |
40167837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40764414 - 40764466
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
40764466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 6912497 - 6912548
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
6912548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 181 - 232
Target Start/End: Complemental strand, 17070865 - 17070814
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
17070865 |
taggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 23382297 - 23382246
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
23382246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 25561705 - 25561756
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
25561756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26133183 - 26133234
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
26133234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 29151852 - 29151801
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
29151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 2636992 - 2636942
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
2636942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3851331 - 3851278
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtc |
3851278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 9179921 - 9179872
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 16038738 - 16038689
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 238
Target Start/End: Original strand, 16616370 - 16616423
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcacta |
238 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtcacta |
16616423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 25779165 - 25779112
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
25779165 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagt |
25779112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 39379237 - 39379290
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
39379237 |
taggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
39379290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 4736201 - 4736249
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggt |
227 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
4736201 |
tttaggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 9179592 - 9179644
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtc |
9179644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 9532532 - 9532484
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
9532484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11799128 - 11799180
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtc |
11799180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15635379 - 15635427
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtc |
15635427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18258161 - 18258213
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtc |
18258213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20416359 - 20416411
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||| |||||||| |||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtc |
20416411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 20418013 - 20417965
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtc |
20417965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20683746 - 20683798
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtc |
20683798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20985728 - 20985776
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
20985776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 20986090 - 20986038
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
20986038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24443379 - 24443431
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
24443431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28213372 - 28213424
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
28213424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29693091 - 29693039
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
29693039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29875399 - 29875451
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | ||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtc |
29875451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 32108804 - 32108856
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||| ||||||| |||||| |
|
|
| T |
32108804 |
tttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta |
32108856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34125633 - 34125581
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtc |
34125581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35876687 - 35876739
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
35876739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 40764781 - 40764729
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtc |
40764729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||| |||||||||| |||||||| || |||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15916286 - 15916337
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| | |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtc |
15916337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||| | |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 21050913 - 21050862
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtc |
21050862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 28871995 - 28871944
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| || |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagt |
28871944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29151516 - 29151567
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc |
29151567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 36973710 - 36973659
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtc |
36973659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 38182088 - 38182041
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
38182088 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 38189043 - 38189090
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
38189043 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 38209314 - 38209267
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
38209314 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 38216268 - 38216315
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
38216268 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 9588598 - 9588560
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9588598 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
9588560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 22551318 - 22551268
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||| | ||||||||||||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtc |
22551268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||| |||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12144905 - 12144958
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
12144905 |
taggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtc |
12144958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 17070534 - 17070575
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttt |
223 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 26071594 - 26071565
Alignment:
| Q |
205 |
ctgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26071594 |
ctgcaaatatgtctcgttttggttttagtc |
26071565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 42207570 - 42207522
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtc-ctacaaatatgcctcgttttggttttagtc |
42207522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6953948 - 6954000
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||| ||| |||||| |||||||| |
|
|
| T |
6953948 |
aggctaaaatatggttttaatcactacaaatatttcttgttttgattttagtc |
6954000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 10830527 - 10830579
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||||| || |||||||||||||| |
|
|
| T |
10830527 |
taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagt |
10830579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26071290 - 26071342
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtc |
26071342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28108159 - 28108111
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| || |||||||| |||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtc |
28108111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 42596814 - 42596766
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtc |
42596766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 172)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 180 - 237
Target Start/End: Complemental strand, 48609597 - 48609540
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48609597 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcact |
48609540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 19622651 - 19622706
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19622651 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19622706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 21391092 - 21391147
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21391092 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
21391147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 13260324 - 13260270
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13260324 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13260270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6567497 - 6567445
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
6567445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14007488 - 14007540
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
14007540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 41358665 - 41358613
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41358665 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
41358613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45290456 - 45290508
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
45290508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 18473596 - 18473537
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta |
241 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagta |
18473537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26191734 - 26191683
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26191683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26442563 - 26442614
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26442614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 32626528 - 32626579
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
32626579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35005748 - 35005693
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35005748 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35005693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 45380268 - 45380323
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45380268 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
45380323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 990382 - 990328
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
990382 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
990328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 8140431 - 8140485
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
8140431 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8140485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 10887601 - 10887547
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10887601 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
10887547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 11822367 - 11822314
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtc |
11822314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13259986 - 13260039
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtc |
13260039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13770487 - 13770540
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13770487 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
13770540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 18473270 - 18473323
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18473270 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18473323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22919682 - 22919735
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22919682 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22919735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 39747837 - 39747784
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
39747837 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
39747784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1810926 - 1810978
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1810978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3247197 - 3247249
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3247249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11822003 - 11822055
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
11822055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12360969 - 12360917
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12360917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15526363 - 15526311
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
15526311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 18302388 - 18302336
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18302336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19720711 - 19720763
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19720763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26061955 - 26062007
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
26062007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29072496 - 29072548
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29072548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30322928 - 30322980
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
30322980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32729050 - 32728998
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
32728998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33000670 - 33000618
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
33000618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33379887 - 33379939
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
33379939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34002941 - 34002889
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
34002889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41358368 - 41358420
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
41358420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41881092 - 41881144
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtc |
41881144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45368489 - 45368541
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
45368541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 48609235 - 48609287
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtc |
48609287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7001897 - 7001846
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7001846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 7867125 - 7867180
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
7867125 |
tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
7867180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10631164 - 10631215
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
10631215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 10887229 - 10887284
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
10887229 |
tttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
10887284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 18899842 - 18899889
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18899889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 22919981 - 22919926
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
22919981 |
tttaggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtc |
22919926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24977778 - 24977829
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24977829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 230
Target Start/End: Original strand, 33067344 - 33067395
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33067344 |
tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35056530 - 35056581
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35056581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 35307714 - 35307765
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35307765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35308111 - 35308060
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35308060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 39303670 - 39303725
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
39303670 |
tttatgctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtc |
39303725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 40718110 - 40718161
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
40718161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 45290824 - 45290769
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
45290824 |
tttaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc |
45290769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 180 - 231
Target Start/End: Complemental strand, 45638897 - 45638846
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
45638897 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46868577 - 46868526
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
46868526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 50429213 - 50429158
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
50429213 |
tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
50429158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 3753214 - 3753264
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3753264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 4789305 - 4789359
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| |||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
4789305 |
ttagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
4789359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 24654168 - 24654118
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 27521577 - 27521627
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
27521627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 32454297 - 32454243
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
32454297 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtc |
32454243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 44641079 - 44641129
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44641129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 7819105 - 7819052
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc |
7819052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21383102 - 21383155
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
21383102 |
taggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc |
21383155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 34808195 - 34808248
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
34808195 |
taggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtc |
34808248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 42482977 - 42483030
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42482977 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 47819230 - 47819283
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
47819230 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
47819283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 50799128 - 50799181
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
50799181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 990087 - 990139
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
990139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3679625 - 3679677
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
3679677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3753573 - 3753521
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
3753521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 7350426 - 7350474
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
7350474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10631529 - 10631477
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
10631477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 12361010 - 12361062
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtc |
12361062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 15211510 - 15211562
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 17984332 - 17984384
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18900130 - 18900082
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
18900082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19623018 - 19622966
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
19622966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24507844 - 24507792
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24507792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26442900 - 26442848
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc |
26442848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29688429 - 29688377
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
29688377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31258338 - 31258390
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
31258390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33045691 - 33045639
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
33045639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35005443 - 35005495
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
35005495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38150851 - 38150899
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
38150899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 38164296 - 38164244
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
38164244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 47819597 - 47819545
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
47819545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 52254182 - 52254234
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
52254234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3247566 - 3247511
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3247566 |
tttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3247511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12158690 - 12158741
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtc |
12158741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 15516578 - 15516633
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
15516578 |
tttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtc |
15516633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 24649664 - 24649609
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
24649664 |
tttaggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
24649609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24653802 - 24653853
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24653853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26191359 - 26191410
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
26191410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 29072862 - 29072811
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtc |
29072811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 30323297 - 30323242
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30323297 |
tttaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
30323242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 31060787 - 31060838
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc |
31060838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 37545628 - 37545679
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc |
37545679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 38151212 - 38151161
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
38151161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 44641432 - 44641381
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
44641381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 48956066 - 48956015
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
48956015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 52254479 - 52254428
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
52254428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 4360627 - 4360577
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag |
4360577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 15058419 - 15058469
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc |
15058469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 26142416 - 26142474
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
|||||||||||||| |||||| || | ||||||||| ||||||||||||||||||||| |
|
|
| T |
26142416 |
tttaggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcact |
26142474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 32420099 - 32420149
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
32420149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 44157696 - 44157746
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
44157746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 16026940 - 16026887
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
16026940 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
16026887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22674201 - 22674254
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
22674201 |
taggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 26207280 - 26207329
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
26207329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26324583 - 26324636
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26324583 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
26324636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 26324949 - 26324896
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26324949 |
taggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35056896 - 35056843
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35056896 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
35056843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 45368847 - 45368798
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtc |
45368798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 49073690 - 49073739
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 50428872 - 50428921
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7350733 - 7350685
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtc |
7350685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 7867358 - 7867306
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtc |
7867306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8140800 - 8140748
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtc |
8140748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
25658062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31061152 - 31061100
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtc |
31061100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31258699 - 31258651
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtc |
31258651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33234545 - 33234597
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
33234597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 36912851 - 36912895
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttg |
225 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
36912851 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 37624745 - 37624793
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38163934 - 38163982
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
38163982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39747473 - 39747524
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttggtc-ctgcaaatacgtctcgttttggttttagtc |
39747524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44158043 - 44157991
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtc |
44157991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 3679986 - 3679935
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc |
3679935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 237
Target Start/End: Original strand, 8364619 - 8364670
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
||||||| |||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcact |
8364670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 8364920 - 8364869
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||||||| ||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
8364920 |
tttaggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 15335292 - 15335245
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| | |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
15335245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 16060595 - 16060649
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
||||||||||| |||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcact |
16060649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16060885 - 16060834
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
16060834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 225
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttg |
225 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 20948755 - 20948806
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| || |||||||||||||||| |||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtc |
20948806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24507479 - 24507530
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
24507530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 26062255 - 26062208
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagt |
26062208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 33000305 - 33000356
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
33000356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 33045351 - 33045406
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
33045351 |
tttaggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtc |
33045406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 37625031 - 37624976
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||||| |||||||||| ||| |||||||| ||||||||||| ||||| |
|
|
| T |
37625031 |
tttaagctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc |
37624976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 38136981 - 38136930
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
38136930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 41739122 - 41739072
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtc |
41739072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 45380636 - 45380585
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
45380585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45638580 - 45638631
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
45638631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 2939934 - 2939980
Alignment:
| Q |
188 |
aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
2939980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 15334915 - 15334965
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| ||||||| || ||| ||||||| ||||||||||||||| |
|
|
| T |
15334915 |
taggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 200 - 234
Target Start/End: Original strand, 18302070 - 18302104
Alignment:
| Q |
200 |
agtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtc |
18302104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 18928141 - 18928091
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtc |
18928091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 292860 - 292910
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
292860 |
aggctaaaat--ggttttagtccctgcaaatatgcctcgttttgcttttagtc |
292910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
4360299 |
taaaatatggttttagtc-ctgcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 4565338 - 4565285
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||||||||||||| |||||||| |
|
|
| T |
4565338 |
taggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtc |
4565285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 28507460 - 28507407
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
28507460 |
taggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtc |
28507407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 32035458 - 32035487
Alignment:
| Q |
205 |
ctgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32035458 |
ctgcaaatatgtctcgttttggttttagtc |
32035487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 46183686 - 46183735
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
46183735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18079397 - 18079449
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| ||| |||||||||||||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtc |
18079449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 19721071 - 19721023
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
19721023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 34002634 - 34002682
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||| || | |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 39025112 - 39025156
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 4037 - 4092
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4037 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
4092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 19219 - 19274
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19219 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4289 - 4237
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
4237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19471 - 19419
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
19419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 3e-18; HSPs: 163)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 39832902 - 39832957
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39832902 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39832957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44344790 - 44344738
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
44344738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 233
Target Start/End: Complemental strand, 48359081 - 48359025
Alignment:
| Q |
177 |
agtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48359081 |
agttttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 13769774 - 13769825
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13769825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 19561450 - 19561399
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19561399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 25988381 - 25988436
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25988381 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25988436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35210515 - 35210464
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
35210464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35838341 - 35838286
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35838341 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35838286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 46759654 - 46759709
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
46759654 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
46759709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 23816667 - 23816721
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23816667 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 30709647 - 30709593
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30709647 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 1614557 - 1614610
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
1614557 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
1614610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 17999723 - 17999670
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
17999723 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
17999670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19783813 - 19783866
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19783813 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
19783866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6108333 - 6108385
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
6108385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8144294 - 8144346
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8144346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12894403 - 12894351
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
12894351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19757747 - 19757799
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
19757799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 23399977 - 23399925
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
23399925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25092159 - 25092211
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25092211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 27458398 - 27458450
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
27458450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28911907 - 28911855
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28911855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35837923 - 35837975
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35837975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44509055 - 44509003
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44509003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1006835 - 1006886
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1006886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1974009 - 1974060
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
1974060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3975842 - 3975787
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3975842 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3975787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 17854145 - 17854200
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17854145 |
tttagactaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
17854200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 20388270 - 20388325
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
20388270 |
tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
20388325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 23399608 - 23399663
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23399608 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
23399663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 23676128 - 23676183
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
23676128 |
tttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
23676183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25547490 - 25547439
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
25547439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 37372441 - 37372488
Alignment:
| Q |
187 |
aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
37372488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 37372905 - 37372854
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37372854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 44403249 - 44403198
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
44403198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 44508720 - 44508771
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44508771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 31310362 - 31310416
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
31310362 |
ttaggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 32189393 - 32189339
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32189393 |
ttagactaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtc |
32189339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 39719645 - 39719591
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
39719645 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtc |
39719591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 43300613 - 43300663
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtc |
43300663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 8144660 - 8144607
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
8144607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 8555800 - 8555751
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 18022706 - 18022653
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18022706 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
18022653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 23676454 - 23676401
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23676454 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
23676401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 26878073 - 26878020
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26878073 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
26878020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28911575 - 28911628
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
28911575 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtc |
28911628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 29198301 - 29198354
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
29198301 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
29198354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29198664 - 29198611
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29198611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35015222 - 35015169
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
35015222 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
35015169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 45671550 - 45671497
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
45671550 |
taggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtc |
45671497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 48192490 - 48192437
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
48192490 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
48192437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 489073 - 489021
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtc |
489021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1614905 - 1614853
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1614853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3975548 - 3975600
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3975600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5234205 - 5234153
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
5234153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6509207 - 6509259
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtc |
6509259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6509471 - 6509419
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
6509419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9659690 - 9659638
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
9659638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14543709 - 14543761
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
14543761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 21223749 - 21223697
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
21223697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25988750 - 25988698
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25988698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26877677 - 26877729
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtc |
26877729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30223460 - 30223512
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtc |
30223512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 39439030 - 39438978
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
39438978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44568691 - 44568639
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44568639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 45021858 - 45021806
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
45021858 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 45073310 - 45073362
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
45073310 |
tttaggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta |
45073362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45073642 - 45073590
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
45073590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45228919 - 45228867
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
45228867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46828943 - 46828995
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc |
46828995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5308323 - 5308374
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
5308374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 5354764 - 5354819
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
5354764 |
tttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
5354819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 10358368 - 10358317
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
10358317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 13770082 - 13770031
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagt |
13770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16853589 - 16853538
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
16853538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 17999465 - 17999512
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 23817035 - 23816984
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagt |
23816984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35104299 - 35104244
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35104299 |
tttaggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35104244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 39833236 - 39833185
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
39833185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 41054240 - 41054185
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
41054240 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
41054185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 41364884 - 41364935
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||| || || ||||||||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtc |
41364935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46304384 - 46304333
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtc |
46304333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46759942 - 46759891
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
46759891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 6079810 - 6079860
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
6079860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 35665874 - 35665928
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| ||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
35665874 |
ttaggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtc |
35665928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 39438738 - 39438792
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
39438738 |
ttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9659353 - 9659406
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
9659353 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc |
9659406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 10357999 - 10358052
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | | |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10357999 |
taggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtc |
10358052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 19465982 - 19465930
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
19465982 |
taggctaaaatatggttttagcc-ctgcaaatatgtctcgtttcggttttagtc |
19465930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 21554755 - 21554702
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| || |||||| |||||||| |
|
|
| T |
21554755 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtc |
21554702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1559706 - 1559654
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtc |
1559654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 3807862 - 3807914
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagt |
3807914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5233807 - 5233859
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
5233859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14739005 - 14738953
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtc |
14738953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 18927091 - 18927039
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtca |
18927039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25092549 - 25092497
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtc |
25092497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 25547251 - 25547303
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||| ||||||| ||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
25547251 |
taggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30223796 - 30223744
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtc |
30223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30352563 - 30352611
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtc |
30352611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 34877777 - 34877825
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
34877825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35104077 - 35104129
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtc |
35104129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39520397 - 39520449
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtc |
39520449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44402959 - 44403011
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| | | |||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtc |
44403011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44568325 - 44568377
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtc |
44568377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44958507 - 44958455
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtc |
44958455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45021494 - 45021546
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgtttt-ggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtc |
45021546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 45671212 - 45671264
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
45671212 |
taggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagt |
45671264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46304085 - 46304137
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtc |
46304137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 48192260 - 48192308
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
48192308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 48852443 - 48852495
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc |
48852495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
187 |
aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 11767279 - 11767224
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| || |||||||||||||| |
|
|
| T |
11767279 |
tttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtc |
11767224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| |||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 21554393 - 21554444
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtc |
21554444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 24717532 - 24717481
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| || | ||||||||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtc |
24717481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 27037593 - 27037644
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
27037644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30352904 - 30352853
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtc |
30352853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35469880 - 35469931
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| || |||||||| ||| |||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46829312 - 46829261
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtc |
46829261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 5355119 - 5355065
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
|||| |||| || |||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
5355119 |
taggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtca |
5355065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 28262711 - 28262761
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
28262711 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28262761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 37527421 - 37527371
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| || ||||||||||| ||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtc |
37527371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 38186747 - 38186709
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
38186747 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 38486474 - 38486528
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| | |||| ||| ||| |||||||||||||||| |||||||| |
|
|
| T |
38486474 |
tttaggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 1559342 - 1559391
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 6892262 - 6892209
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||| |||||| ||||||| ||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtc |
6892209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 12932785 - 12932732
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
12932785 |
taggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtc |
12932732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 37952671 - 37952720
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtc |
37952720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 233
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||| ||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43058752 - 43058801
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtc |
43058801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 44344456 - 44344505
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
44344456 |
aggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 189 - 229
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
189 |
aatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 234
Target Start/End: Complemental strand, 1271588 - 1271548
Alignment:
| Q |
194 |
ggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1271588 |
ggttttggtccctgcaaatatgcctcgttttggttttagtc |
1271548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2945846 - 2945794
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| || |||||||| |||||||||||||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtc |
2945794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5308687 - 5308636
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtc |
5308636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 6589271 - 6589223
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtc |
6589223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 8555603 - 8555655
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
8555603 |
tttaggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta |
8555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16940761 - 16940813
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||| |||||| ||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtc |
16940813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 16941049 - 16941001
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
16941001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30709328 - 30709376
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| | |||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtc |
30709376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 38486794 - 38486738
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
|||||||||||||| |||||| || ||| ||||||| | ||||||||||||||||| |
|
|
| T |
38486794 |
tttaggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtca |
38486738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 39520727 - 39520679
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtc |
39520679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41053841 - 41053893
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| ||||| |||||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtc |
41053893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 48854071 - 48854019
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtc |
48854019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 180)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 24474964 - 24474905
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta |
241 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctagta |
24474905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 46088064 - 46088009
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46088064 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
46088009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 45593590 - 45593536
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45593590 |
tttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagt |
45593536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9289264 - 9289317
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9289264 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
9289317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 13479613 - 13479560
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13479560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 13631223 - 13631279
Alignment:
| Q |
178 |
gtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13631223 |
gtttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
13631279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22099913 - 22099861
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29380911 - 29380859
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
29380859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 34361802 - 34361854
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
34361854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 32208541 - 32208600
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta |
241 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagta |
32208600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 35464014 - 35464069
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35464014 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35464069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 50714565 - 50714514
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
50714514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 32365090 - 32365144
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
32365090 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32365144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 35763644 - 35763698
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35763644 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35763698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 51708690 - 51708744
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
51708690 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 52430103 - 52430049
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
52430103 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc |
52430049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 5882542 - 5882602
Alignment:
| Q |
173 |
gaaaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| |||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5882542 |
gaaaaatttaggctaaaatatggttttagtc-ctgcaaatatgcctcgttttggttttagtc |
5882602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9289641 - 9289588
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
9289588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22584285 - 22584338
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22584285 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29420539 - 29420486
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29420486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35119613 - 35119560
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
35119613 |
taggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtc |
35119560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 41346220 - 41346167
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
41346167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 52441761 - 52441814
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
52441761 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
52441814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 53716919 - 53716972
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
53716919 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
53716972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13064466 - 13064414
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
13064414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14791807 - 14791755
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
14791755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16712692 - 16712640
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16712640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18205155 - 18205207
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18205207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 18205521 - 18205473
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18205473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25423923 - 25423975
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25423975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25424313 - 25424261
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25424261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32365484 - 32365432
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
32365432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 36701999 - 36702051
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
36702051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41345852 - 41345904
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
41345904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 43231087 - 43231139
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
43231139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46115780 - 46115728
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtc |
46115728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46128914 - 46128862
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtc |
46128862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 52017504 - 52017556
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
52017556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52017871 - 52017819
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
52017819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52442093 - 52442041
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
52442041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 53916049 - 53915997
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
53916049 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
53915997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 4279018 - 4279073
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
4279018 |
tttaggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtc |
4279073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 13064155 - 13064210
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
13064155 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
13064210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 13073759 - 13073810
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
13073810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 14488191 - 14488136
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14488191 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
14488136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 235
Target Start/End: Complemental strand, 15555637 - 15555586
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtca |
15555586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 22099543 - 22099594
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22099594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35415633 - 35415582
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35415582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 233
Target Start/End: Original strand, 42823767 - 42823826
Alignment:
| Q |
174 |
aaaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||| |||||||||||||| | |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
42823767 |
aaaattttaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42823826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 45505895 - 45505844
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45505844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 53717174 - 53717123
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
53717123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 123532 - 123585
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
123532 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
123585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 11693123 - 11693070
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11693123 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtc |
11693070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 12152495 - 12152446
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19903653 - 19903604
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19903604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 23245597 - 23245544
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
23245544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26412188 - 26412241
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
26412188 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
26412241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 176 - 241
Target Start/End: Complemental strand, 32208908 - 32208843
Alignment:
| Q |
176 |
aagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta |
241 |
Q |
| |
|
||||| ||||||||||| ||||||| || ||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
32208908 |
aagttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccctagta |
32208843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 41619897 - 41619950
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
41619950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43368467 - 43368516
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
43368516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 51545971 - 51545918
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
51545971 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
51545918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2034856 - 2034804
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtc |
2034804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2180219 - 2180271
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
2180271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5052585 - 5052533
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
5052533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5827974 - 5827922
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc |
5827922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6827875 - 6827823
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
6827823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8760603 - 8760655
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtc |
8760655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8760782 - 8760730
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtc |
8760730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13530714 - 13530662
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
13530662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13631600 - 13631548
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc |
13631548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15555506 - 15555554
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
15555554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 23779226 - 23779174
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtc |
23779174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24774044 - 24774096
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24774096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28809181 - 28809129
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
28809129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 29380667 - 29380715
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 230
Target Start/End: Complemental strand, 29463914 - 29463866
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29499181 - 29499233
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29499233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30046793 - 30046741
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
30046741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30061134 - 30061082
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
30061082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31812214 - 31812162
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc |
31812162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38054549 - 38054597
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
38054597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 41921085 - 41921033
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtc |
41921033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 42848026 - 42848078
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc |
42848078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43231390 - 43231338
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
43231338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45505599 - 45505651
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
45505651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46292652 - 46292600
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51545628 - 51545680
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 51709028 - 51708976
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 55072388 - 55072440
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
55072440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 2322433 - 2322382
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2322382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4279335 - 4279284
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtc |
4279284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5827655 - 5827706
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
5827706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 12791978 - 12791923
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12791978 |
tttaggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtc |
12791923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 13074129 - 13074074
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
13074129 |
tttaggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc |
13074074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 13764613 - 13764664
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtc |
13764664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14594202 - 14594257
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||| ||||||||||||| |
|
|
| T |
14594202 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtc |
14594257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 19321859 - 19321808
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
19321808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 22584611 - 22584556
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
22584611 |
tttaggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtc |
22584556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 23245231 - 23245282
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
23245282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26412584 - 26412533
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
26412533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 27008084 - 27008135
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
27008135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 28809011 - 28809062
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtc |
28809062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31560695 - 31560644
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
31560644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35464382 - 35464331
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35464331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42848391 - 42848340
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
42848340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 46115414 - 46115465
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
46115465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 46128548 - 46128599
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
46128599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 50714240 - 50714291
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
50714291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 53308068 - 53308017
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtc |
53308017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 11285504 - 11285554
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
11285554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 27008401 - 27008355
Alignment:
| Q |
188 |
aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtc |
27008355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 36050289 - 36050339
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtc |
36050339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 47023108 - 47023054
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
47023108 |
ttaggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
47023054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 47136170 - 47136120
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
47136120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 51738135 - 51738185
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
51738135 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 55072714 - 55072664
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
55072714 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 4211559 - 4211608
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9445951 - 9446000
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
9446000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13530377 - 13530430
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
13530377 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc |
13530430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 14487800 - 14487849
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18831176 - 18831127
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
18831127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 20291984 - 20292037
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20291984 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28448832 - 28448885
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30564835 - 30564884
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtc |
30564884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 34355285 - 34355232
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
34355285 |
taggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtc |
34355232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 35415297 - 35415350
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
35415297 |
taggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc |
35415350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35763957 - 35763904
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
35763957 |
taggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtc |
35763904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 53915681 - 53915734
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
53915681 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
53915734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 5797484 - 5797532
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| | |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtc |
5797532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13764808 - 13764756
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtc |
13764756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24474599 - 24474650
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtc-ctgcaaatatgcatcgttttggttttagtc |
24474650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26314333 - 26314281
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtc |
26314281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 27427871 - 27427922
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtc |
27427922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29499543 - 29499495
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29499495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31182505 - 31182453
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtc |
31182453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 31370802 - 31370854
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
31370802 |
taggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31811924 - 31811976
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtc |
31811976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 36054151 - 36054099
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtc |
36054099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 41620257 - 41620205
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc |
41620205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45474597 - 45474545
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 47022743 - 47022791
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
47022791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 54903476 - 54903424
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| | |||||||||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtc |
54903424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2180572 - 2180521
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtc |
2180521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8191391 - 8191340
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||| ||||| |||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtc |
8191340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Complemental strand, 9446323 - 9446276
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||| | |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25358540 - 25358489
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtc |
25358489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 41324890 - 41324839
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtc |
41324839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42824091 - 42824040
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||| |||||| |||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtc |
42824040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 46292392 - 46292439
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 55482468 - 55482417
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtc |
55482417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 123893 - 123847
Alignment:
| Q |
188 |
aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
123847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 5797822 - 5797772
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||| ||||||| |||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
5797822 |
taggttaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6353637 - 6353587
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc |
6353587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 194 - 228
Target Start/End: Complemental strand, 25358498 - 25358464
Alignment:
| Q |
194 |
ggttttagtcactgcaaatatgtctcgttttggtt |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
25358498 |
ggttttagtccctgcaaatatgtctcgttttggtt |
25358464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 36702362 - 36702312
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtc |
36702312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 44925844 - 44925794
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| | ||||||||| |||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtc |
44925794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 45593225 - 45593279
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| ||||||||| || |||||||| |||||||||| ||||||| |
|
|
| T |
45593225 |
ttaggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtc |
45593279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 2322094 - 2322143
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||| |||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
2322143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12152152 - 12152205
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
12152152 |
taggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtc |
12152205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 30060767 - 30060820
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
30060767 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtc |
30060820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35420701 - 35420652
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||| ||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtc |
35420652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 41439785 - 41439838
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||||| | ||| |||||| ||||||||||||||||||| |
|
|
| T |
41439785 |
taggttaaaatatggttttagcctctgtaaatatttctcgttttggttttagtc |
41439838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 47532667 - 47532622
Alignment:
| Q |
188 |
aaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47532622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 51830891 - 51830940
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtc |
51830940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 5202929 - 5202985
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcg-ttttggttttagtcactagta |
241 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccctagta |
5202985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28197278 - 28197230
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| || |||||||||||||| || ||||||||| |
|
|
| T |
28197278 |
taaaatatggttttagtctctacaaatatgtctcgtctttgttttagtc |
28197230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31560330 - 31560382
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtc |
31560382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35119291 - 35119343
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtc |
35119343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 162)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 40786456 - 40786511
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40786456 |
tttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtc |
40786511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 38639409 - 38639463
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38639409 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 10671943 - 10671890
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10671943 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
10671890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 11788418 - 11788365
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11788418 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
11788365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19183781 - 19183833
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19183833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5790899 - 5790848
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
5790848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 11713485 - 11713536
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
11713536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 20131313 - 20131368
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
20131313 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20131368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 238
Target Start/End: Original strand, 23989834 - 23989893
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcacta |
238 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
23989834 |
tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcacta |
23989893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26813866 - 26813917
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26813917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 36622250 - 36622301
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
36622301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 44985988 - 44985933
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
44985988 |
tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
44985933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 9195054 - 9195104
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
9195104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13215058 - 13215111
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13215058 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
13215111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 26239162 - 26239109
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
26239109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 40302341 - 40302288
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40302341 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
40302288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 41451835 - 41451888
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
41451835 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
41451888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 43788856 - 43788909
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43788856 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
43788909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 44559060 - 44559113
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
44559060 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4424186 - 4424134
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
4424134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11713846 - 11713794
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
11713794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16900207 - 16900155
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16900155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16993598 - 16993546
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16993546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 17541777 - 17541725
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
17541725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19184152 - 19184100
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
19184100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22881612 - 22881664
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22881664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24483892 - 24483840
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
24483840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25705084 - 25705136
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25705136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26814230 - 26814178
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
26814178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31644840 - 31644892
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33576118 - 33576066
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
33576066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33732861 - 33732913
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
33732913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37271738 - 37271790
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37271790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37272103 - 37272051
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37272051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 38980254 - 38980202
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
38980202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41693673 - 41693725
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
41693725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 17912445 - 17912500
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17912445 |
tttaggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 24358612 - 24358667
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24358612 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24358667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 25705453 - 25705398
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25705453 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25705398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 33575748 - 33575803
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
33575748 |
tttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
33575803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 42695868 - 42695919
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
42695919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 43597150 - 43597205
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43597150 |
tttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
43597205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 44985617 - 44985672
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44985617 |
tttagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44985672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 10664981 - 10665035
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
10664981 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtc |
10665035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 20939324 - 20939274
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20939274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 23990193 - 23990143
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcac |
236 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcac |
23990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 43592043 - 43592097
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
43592043 |
ttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
43592097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9195208 - 9195155
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtc |
9195155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 10374775 - 10374824
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10374824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 10671628 - 10671681
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
10671681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 16523327 - 16523274
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16523327 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
16523274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 27311071 - 27311018
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc |
27311018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 35155298 - 35155343
Alignment:
| Q |
189 |
aatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
35155343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2265398 - 2265346
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc |
2265346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2481558 - 2481506
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
2481506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3837932 - 3837984
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtc |
3837984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4423894 - 4423946
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
4423946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8046328 - 8046380
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
8046380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14003743 - 14003691
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
14003691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15842824 - 15842772
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
15842772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16522990 - 16523042
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
16523042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16673410 - 16673462
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
16673462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 17302144 - 17302092
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc |
17302092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 17541381 - 17541433
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc |
17541433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25954114 - 25954166
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtc |
25954166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26238816 - 26238864
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
26238864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29859873 - 29859821
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29859821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37228732 - 37228784
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38731828 - 38731880
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
38731880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 42358702 - 42358750
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
42358750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43597500 - 43597448
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc |
43597448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44073808 - 44073756
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
44073756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44994062 - 44994010
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
44994062 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45442697 - 45442645
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc |
45442645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 146690 - 146639
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
146639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1138363 - 1138308
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
1138363 |
tttaggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtc |
1138308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 3671192 - 3671141
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3671141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4042890 - 4042839
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtc |
4042839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 4794130 - 4794181
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
4794181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5334751 - 5334802
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5334802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5335040 - 5334989
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5334989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5790558 - 5790609
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtc |
5790609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 7814741 - 7814686
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
7814741 |
tttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtc |
7814686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8046648 - 8046597
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
8046597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 180 - 235
Target Start/End: Complemental strand, 13215368 - 13215313
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
||||||||||||| || ||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
13215368 |
ttaggctaaaatatgggtttggtccctgcaaatatgtctcgttttggttttggtca |
13215313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14003405 - 14003460
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14003405 |
tttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
14003460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 20131681 - 20131630
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
20131630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 27310875 - 27310922
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 36806892 - 36806845
Alignment:
| Q |
187 |
aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
36806845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 36815836 - 36815785
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagt |
36815785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 41694003 - 41693952
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
41693952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 146323 - 146377
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| |||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
146323 |
ttagactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
146377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 3671000 - 3671054
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
3671000 |
ttaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtc |
3671054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 3838263 - 3838213
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
3838213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 15842458 - 15842512
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| ||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15842458 |
ttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
15842512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 16673774 - 16673720
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
16673774 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc |
16673720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 230
Target Start/End: Complemental strand, 20658412 - 20658362
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
20658412 |
ttaggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29865222 - 29865272
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
29865272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 32691311 - 32691361
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32691311 |
taggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3832639 - 3832586
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3832639 |
taggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 11943543 - 11943588
Alignment:
| Q |
188 |
aaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggttttagt |
11943588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 20658059 - 20658112
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtc |
20658112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26709694 - 26709747
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29865513 - 29865460
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
29865513 |
taggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc |
29865460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30215873 - 30215820
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| || |||||||||||||||| |
|
|
| T |
30215873 |
taggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtc |
30215820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2481192 - 2481244
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtc |
2481244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4042609 - 4042661
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
4042661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7814245 - 7814297
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtc |
7814297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18113088 - 18113140
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtc |
18113140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24358946 - 24358894
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
24358894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29859490 - 29859538
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29859538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30215421 - 30215473
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
30215473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 38979889 - 38979941
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgt-ctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtc |
38979941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40301974 - 40302026
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| |||| ||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
40302026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43789193 - 43789141
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtc |
43789141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 10665295 - 10665244
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagt |
10665244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12835325 - 12835376
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtc |
12835376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 19831511 - 19831558
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagt |
19831558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 23732039 - 23732090
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtc |
23732090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 23732329 - 23732282
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 27109073 - 27109124
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| || |||||||| |||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtc |
27109124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 31225714 - 31225765
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
31225765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34317798 - 34317849
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
34317849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
188 |
aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| |||||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4842865 - 4842915
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtc |
4842915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 24483401 - 24483451
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| || ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtc |
24483451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 224
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgtttt |
224 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 40124966 - 40125016
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
40125016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 42696202 - 42696152
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
42696152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 43710394 - 43710432
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
43710394 |
ttttagtcccttcaaatatgtctcgttttggttttagtc |
43710432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 44993806 - 44993851
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtc-ctgcaaatatgtctcgttttggtttta |
44993851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1497943 - 1497894
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtc |
1497894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13850520 - 13850573
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
13850520 |
taggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtc |
13850573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 14393107 - 14393078
Alignment:
| Q |
205 |
ctgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14393107 |
ctgcaaatatgtctcgttttggttttagtc |
14393078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 22881946 - 22881917
Alignment:
| Q |
205 |
ctgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22881946 |
ctgcaaatatgtctcgttttggttttagtc |
22881917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26707871 - 26707924
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
26707871 |
taggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtc |
26707924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 29182445 - 29182392
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||| |||||||| | |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
29182445 |
ttagactaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 31909480 - 31909428
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 36815486 - 36815539
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||||||||||||||||||||||| |
|
|
| T |
36815486 |
taggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtc |
36815539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 37911121 - 37911072
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37911072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 41791020 - 41791069
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtc |
41791069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3172019 - 3172071
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtc |
3172071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3172533 - 3172481
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtc |
3172481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 16968555 - 16968603
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| || |||||||| || ||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtc |
16968603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31326253 - 31326201
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtc |
31326201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32476094 - 32476146
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| ||| |||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtc |
32476146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 33576075 - 33576039
Alignment:
| Q |
194 |
ggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
33576075 |
ggttttagtccctgcaaatatgtctcattttggtttt |
33576039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 35155620 - 35155568
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||| |||||||||| |||||| |||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtc |
35155568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43592381 - 43592329
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||| ||||| |||||||| |
|
|
| T |
43592381 |
aggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtc |
43592329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43672319 - 43672267
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| |||||||||||| | ||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtc |
43672267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43710709 - 43710657
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtc |
43710657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 1e-17; HSPs: 151)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 179 - 241
Target Start/End: Complemental strand, 24955014 - 24954952
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta |
241 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
24955014 |
tttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagta |
24954952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 8094477 - 8094530
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8094477 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtc |
8094530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 29158352 - 29158405
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29158352 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
29158405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7272419 - 7272471
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14238750 - 14238802
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
14238802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 19494117 - 19494169
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19494117 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19494169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3512270 - 3512215
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3512270 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3512215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 10337115 - 10337170
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10337115 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
10337170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 16789074 - 16789125
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
16789125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 25131110 - 25131161
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
25131161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 1526174 - 1526121
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1526174 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
1526121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 35097326 - 35097379
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35097326 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35097379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35347000 - 35346947
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35347000 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35346947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 40492958 - 40493011
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtc |
40493011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1525808 - 1525860
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7420229 - 7420281
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
7420281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 7420591 - 7420539
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtc |
7420539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8298976 - 8298924
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8298924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 9496339 - 9496391
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
9496391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11019519 - 11019571
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
11019571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14239081 - 14239029
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
14239029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16644045 - 16643993
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
16643993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19494414 - 19494362
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
19494362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22650463 - 22650515
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
22650515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22917563 - 22917615
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22917615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24187898 - 24187846
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
24187846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 25600228 - 25600280
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
25600228 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25600280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 27341592 - 27341540
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
27341540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32418317 - 32418369
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
32418369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32725906 - 32725958
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
32725958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 43477162 - 43477214
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
43477214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1778564 - 1778615
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
1778615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7186004 - 7185953
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
7185953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 8298587 - 8298638
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8298638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 11019861 - 11019806
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11019861 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
11019806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 11976740 - 11976685
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
11976740 |
tttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
11976685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 14489073 - 14489022
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
14489022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 14495068 - 14495119
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14495119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15719656 - 15719707
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtc |
15719707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 16643657 - 16643712
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
16643657 |
tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
16643712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16789369 - 16789318
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16789318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 28346762 - 28346707
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28346762 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
28346707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 33526416 - 33526361
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33526416 |
tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
33526361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 34963664 - 34963613
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
34963613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35346629 - 35346680
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35346680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 38930301 - 38930352
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38930352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42133154 - 42133103
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
42133103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 4473701 - 4473755
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
4473701 |
ttaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
4473755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 4710223 - 4710169
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4710223 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
4710169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 10776499 - 10776449
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10776449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 8094843 - 8094790
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
8094790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 17073805 - 17073858
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17073805 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
17073858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 17574465 - 17574412
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17574465 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
17574412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 18549199 - 18549252
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
18549199 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18549571 - 18549522
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtc |
18549522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 28258243 - 28258190
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
28258243 |
taggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtc |
28258190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 32726273 - 32726220
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
32726220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 33636320 - 33636373
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
33636320 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
33636373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 43727431 - 43727383
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtc-ctgcaaatatgtctcgttttggttttagtc |
43727383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1685117 - 1685165
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1685165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2728231 - 2728283
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
2728283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4017301 - 4017249
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
4017249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11976372 - 11976424
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
11976424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 13155255 - 13155203
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
13155255 |
tttaggctaaaatatggtttttgttcctgcaaatatgtctcgttttggtttta |
13155203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 13232201 - 13232249
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
13232249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20984145 - 20984197
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
20984197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 20984511 - 20984459
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
20984459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28346393 - 28346445
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
28346445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29488111 - 29488059
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
29488059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 34963299 - 34963351
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
34963351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 35345621 - 35345569
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
35345621 |
tttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37536085 - 37536137
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
37536137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40844532 - 40844484
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtc |
40844484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2728597 - 2728546
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
2728546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 3511902 - 3511957
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| || |||||||| |||||||||||||||||| |
|
|
| T |
3511902 |
tttaggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtc |
3511957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7272751 - 7272700
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtc |
7272700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7326421 - 7326370
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
7326370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 10540445 - 10540500
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10540445 |
tttaggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtc |
10540500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 10873280 - 10873229
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc |
10873229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 20278061 - 20278006
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
20278061 |
tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtc |
20278006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 21064688 - 21064633
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
21064688 |
tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtc |
21064633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25131447 - 25131396
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
25131396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 27117749 - 27117804
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
27117749 |
tttaggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc |
27117804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 29158669 - 29158618
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtc |
29158618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt |
229 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 32040071 - 32040126
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | | |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
32040071 |
tttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtc |
32040126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35097692 - 35097641
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35097641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 40066496 - 40066547
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagt |
40066547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40066820 - 40066769
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtc |
40066769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 40844156 - 40844207
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
40844207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42430120 - 42430069
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42430069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 6146517 - 6146567
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6146567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6146948 - 6146898
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
6146898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 6469670 - 6469616
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6469670 |
ttaggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtc |
6469616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 10337452 - 10337398
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
10337452 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
10337398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 5357421 - 5357474
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5357421 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
5357474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 180 - 233
Target Start/End: Original strand, 6469277 - 6469330
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||||| || ||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
6469277 |
ttaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagt |
6469330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 7326084 - 7326137
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
7326084 |
taggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtc |
7326137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19962993 - 19963046
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
19962993 |
taggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtc |
19963046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 21125718 - 21125767
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 28399037 - 28398984
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
28399037 |
taggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtc |
28398984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 38930665 - 38930616
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1408354 - 1408302
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| |||| ||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
1408302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 4376014 - 4375959
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca |
235 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
4376014 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtca |
4375959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4474045 - 4473993
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
4473993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 9175011 - 9175063
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtc |
9175063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9496724 - 9496672
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
9496672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10540783 - 10540731
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
10540731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10872914 - 10872966
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
10872966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14488715 - 14488767
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc |
14488767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14496815 - 14496867
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtc |
14496867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20277691 - 20277743
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
20277743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21064318 - 21064370
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
21064370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24187568 - 24187620
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
24187620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24815069 - 24815017
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| | | ||||||||||||||| |||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtc |
24815017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25600598 - 25600546
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtc |
25600546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28323848 - 28323900
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtc |
28323900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28324182 - 28324130
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| || ||||||||||| ||||||||||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtc |
28324130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1162909 - 1162960
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtc |
1162960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4621354 - 4621303
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtc |
4621303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 9175375 - 9175320
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| |||||| ||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
9175375 |
tttaggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 14495389 - 14495339
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| ||| |||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtc |
14495339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29487750 - 29487801
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtc |
29487801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 33526052 - 33526103
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
33526103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| |||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 37536419 - 37536368
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
37536368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 44998263 - 44998212
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtc |
44998212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 21126024 - 21125970
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
21126024 |
ttaggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtc |
21125970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 14848168 - 14848139
Alignment:
| Q |
205 |
ctgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14848168 |
ctgcaaatatgtctcgttttggttttagtc |
14848139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 27117977 - 27117920
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactag |
239 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||| ||| |||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccctag |
27117920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 35115641 - 35115592
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||| |||||||||||||| |
|
|
| T |
35115641 |
taggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35143846 - 35143793
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||| || || ||||||| |||||||||||||||||| |
|
|
| T |
35143846 |
taggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtc |
35143793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 228
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtt |
228 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 1778917 - 1778881
Alignment:
| Q |
195 |
gttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggtttta |
1778881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 234
Target Start/End: Complemental strand, 2356225 - 2356197
Alignment:
| Q |
206 |
tgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2356225 |
tgcaaatatgtctcgttttggttttagtc |
2356197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 234
Target Start/End: Original strand, 4709929 - 4709957
Alignment:
| Q |
206 |
tgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtc |
4709957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||| || ||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag |
13779483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28497254 - 28497306
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtc |
28497306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28497616 - 28497568
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
28497568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 1e-17; HSPs: 179)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 179 - 241
Target Start/End: Original strand, 3151746 - 3151808
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta |
241 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
3151746 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagta |
3151808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 34238595 - 34238649
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34238595 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
34238649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22008525 - 22008577
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22008577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22016043 - 22016095
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22016095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 30130156 - 30130208
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30130156 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
30130208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39288572 - 39288624
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39436717 - 39436769
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39436769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3152115 - 3152060
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3152115 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3152060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3830520 - 3830465
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3830520 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3830465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 12740903 - 12740958
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
12740903 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12740958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 22155925 - 22155980
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
22155925 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
22155980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 31869960 - 31869905
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
31869960 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc |
31869905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 51550450 - 51550395
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
51550450 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
51550395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 53701663 - 53701612
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
53701612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 21159821 - 21159767
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
21159821 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
21159767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28427243 - 28427296
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28427243 |
taggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtc |
28427296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29446208 - 29446155
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29446208 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
29446155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29490745 - 29490692
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
29490745 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 37506865 - 37506918
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37506865 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37506918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 47336583 - 47336530
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
47336583 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
47336530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 54608865 - 54608812
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
54608865 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54608812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 474043 - 474095
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
474095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 474410 - 474358
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
474410 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
474358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4513262 - 4513314
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
4513314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4513621 - 4513569
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtc |
4513569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4814899 - 4814848
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtc-ctgcaaatatgtctcgttttggttttagtc |
4814848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4950036 - 4950088
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
4950088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12741272 - 12741220
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12741220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 20612899 - 20612847
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
20612847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21159452 - 21159504
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
21159504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28427609 - 28427557
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28427557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29525104 - 29525156
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc |
29525156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37507223 - 37507171
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37507171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 39437110 - 39437058
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
39437058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 46901102 - 46901154
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
46901102 |
taggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51834607 - 51834659
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
51834659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 4034717 - 4034768
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
4034768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 9863404 - 9863353
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtc |
9863353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10976978 - 10977029
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
10977029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 15979705 - 15979650
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
15979705 |
tttaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
15979650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25710870 - 25710819
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
25710819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26090078 - 26090027
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
26090027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 39288902 - 39288847
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
39288902 |
tttaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
39288847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40169654 - 40169603
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
40169603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 51834946 - 51834891
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
51834946 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
51834891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 3830131 - 3830185
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
3830131 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
3830185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 22156292 - 22156242
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22156242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 25710507 - 25710561
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
25710507 |
ttaggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
25710561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 28552386 - 28552332
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28552386 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
28552332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 29955670 - 29955616
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| ||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
29955670 |
tttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29955616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 30004825 - 30004771
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| ||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
30004825 |
tttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30004771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 30128280 - 30128334
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30128280 |
tttaggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagt |
30128334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 43441270 - 43441320
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
43441320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 7518449 - 7518396
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||| |||||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
7518449 |
ttagactaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 8510539 - 8510478
Alignment:
| Q |
173 |
gaaaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||||| | |||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8510539 |
gaaaagattaggcaacaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
8510478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9262157 - 9262104
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9262157 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
9262104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 50196301 - 50196350
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
50196350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 51550080 - 51550133
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
51550133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3387605 - 3387553
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtc |
3387553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5345690 - 5345638
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
5345638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13584368 - 13584316
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
13584316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14633890 - 14633838
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| || |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtc |
14633838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20611019 - 20611071
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25615974 - 25616026
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25616026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26799887 - 26799939
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
26799939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 28942523 - 28942575
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
28942523 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28942906 - 28942854
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
28942854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30130505 - 30130453
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtc |
30130453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30268504 - 30268556
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
30268556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30552479 - 30552427
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtc |
30552427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31480135 - 31480187
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
31480187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35569133 - 35569085
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35569085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40169343 - 40169395
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtc |
40169395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 43440494 - 43440546
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
43440546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 45002019 - 45002071
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
45002019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
45002071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45002386 - 45002334
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc |
45002334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 45161116 - 45161164
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtc |
45161164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45320980 - 45320928
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
45320928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46186772 - 46186720
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46751270 - 46751322
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
46751322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47005153 - 47005205
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtc |
47005205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 51500686 - 51500634
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtc |
51500634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51759818 - 51759870
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtc |
51759870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52342584 - 52342532
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtc |
52342532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 54608517 - 54608569
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
54608569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 8510214 - 8510265
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtc |
8510265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 13514581 - 13514526
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
13514581 |
tttaggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtc |
13514526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15016388 - 15016439
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
15016439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16123139 - 16123190
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
16123190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 22008890 - 22008839
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
22008839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 28452143 - 28452198
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
28452143 |
tttaggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtc |
28452198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29445954 - 29446005
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
29446005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||||||| | |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40370589 - 40370538
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
40370538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 40545560 - 40545615
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
40545560 |
tttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtc |
40545615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 47005523 - 47005468
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
47005523 |
tttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtc |
47005468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 49323782 - 49323833
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
49323833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 53113442 - 53113497
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact |
237 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgtttttggtcact |
53113497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 32119217 - 32119271
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32119217 |
ttaggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtc |
32119271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 44802282 - 44802332
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagt |
44802332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 275442 - 275495
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |||| ||||||||| |||||||| |
|
|
| T |
275442 |
taggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtc |
275495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9603627 - 9603680
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
9603627 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
9603680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28552019 - 28552072
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc |
28552072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 29955300 - 29955349
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
29955349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30004454 - 30004503
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
30004503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30034474 - 30034421
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
30034474 |
taggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtc |
30034421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30106222 - 30106169
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
30106222 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc |
30106169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 31869596 - 31869645
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtc |
31869645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 36672961 - 36673014
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36672961 |
taggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 40979711 - 40979662
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta |
40979662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 46622131 - 46622078
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtc |
46622078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 49324148 - 49324095
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
49324148 |
taggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
49324095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 50196659 - 50196606
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||| |||||||| ||||||||| |
|
|
| T |
50196659 |
taggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtc |
50196606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 51500396 - 51500449
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||| ||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
51500396 |
taggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1721453 - 1721401
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
1721401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 3387268 - 3387316
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
3387316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7518089 - 7518141
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||| |||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtc |
7518141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 8940522 - 8940474
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
8940474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10977342 - 10977290
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| || |||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtc |
10977290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 12673643 - 12673695
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
12673643 |
aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtc |
12673695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14772210 - 14772262
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
14772262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19656540 - 19656592
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtc |
19656592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19844582 - 19844530
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
19844530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20757403 - 20757451
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
20757451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32119585 - 32119533
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
32119533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34238916 - 34238864
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
34238916 |
aggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtc |
34238864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38232240 - 38232292
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtc |
38232292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43441604 - 43441552
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
43441552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47336227 - 47336279
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
47336279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 48924241 - 48924189
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
48924189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 52342191 - 52342243
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
52342191 |
tttaggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 863277 - 863332
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| | |||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
863277 |
tttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtc |
863332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 1721085 - 1721140
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| ||||||| |||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
1721085 |
tttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtc |
1721140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 9261789 - 9261840
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
9261840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15979338 - 15979389
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
15979389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 18175791 - 18175830
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgtt |
222 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtt |
18175830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26089730 - 26089781
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
26089781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30426226 - 30426176
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtc-ctgcaaatatgcctcgttttgattttagtc |
30426176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31480500 - 31480449
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| || ||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtc |
31480449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 45521833 - 45521786
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagt |
45521786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 50261936 - 50261885
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 4035053 - 4035003
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||| |||||||| |||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagt |
4035003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 9596759 - 9596809
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtc |
9596809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 9603921 - 9603871
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
9603921 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 11463233 - 11463283
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtc |
11463283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 21553888 - 21553938
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag |
232 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||| ||||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
21553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 25610129 - 25610079
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
25610079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 27681684 - 27681634
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| |||| | ||| ||||||||||| ||||||||||||||| |
|
|
| T |
27681684 |
taggctaaaatatggttctggtctctgcaaatatgcctcgttttggtttta |
27681634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 28452379 - 28452325
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||||| |||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
28452379 |
ttaggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtc |
28452325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 30552144 - 30552197
Alignment:
| Q |
180 |
ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||| ||||||| |||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
30552144 |
ttaggttaaaatatggttttagac-ctgcaaatatgtcttgttttggttttagtc |
30552197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 40370285 - 40370335
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagt |
40370335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 43440774 - 43440736
Alignment:
| Q |
196 |
ttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43440774 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
43440736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 45006247 - 45006201
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45006201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 46186410 - 46186460
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||| | |||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc |
46186460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 7588316 - 7588369
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9863045 - 9863097
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| |||||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
9863045 |
taggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtc |
9863097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 20907459 - 20907406
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||| ||||||| ||||||| || ||||||||||| ||| |||||||||||||| |
|
|
| T |
20907459 |
taggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtc |
20907406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35407792 - 35407739
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||| ||||| ||||||||| |
|
|
| T |
35407792 |
taggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtc |
35407739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 863649 - 863601
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||| |||||||| |||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtc |
863601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 4322186 - 4322138
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtc |
4322138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9597096 - 9597044
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtc |
9597044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 25610060 - 25610024
Alignment:
| Q |
194 |
ggttttagtcactgcaaatatgtctcgttttggtttt |
230 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
25610060 |
ggttttggtccctgcaaatatgtctcgttttggtttt |
25610024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29678023 - 29678075
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtc |
29678075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29686543 - 29686595
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||| |||| |||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtc |
29686595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35565507 - 35565559
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtc |
35565559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta |
39072165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40545836 - 40545788
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| | |||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtc |
40545788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 45005889 - 45005937
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtc |
45005937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 47901803 - 47901851
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtc |
47901851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 49670803 - 49670751
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcac-tgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtc |
49670751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1310 - 1362
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
1362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1645 - 1593
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtc |
1593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 290 - 238
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12525 - 12576
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
12576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3295 - 3240
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3295 |
tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
3240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 27368 - 27313
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
27368 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
27313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 3532 - 3583
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
3583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3919 - 3867
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
3867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 14695 - 14748
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
14748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15013 - 14961
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
14961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2777 - 2829
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8329 - 8381
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
8381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8643 - 8591
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
8591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5709 - 5657
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
5657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5398 - 5450
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 10517 - 10465
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10517 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
10465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10168 - 10219
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
10219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47924 - 47976
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
47976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 223176 - 223121
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||| ||||||||||||| |
|
|
| T |
223176 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtc |
223121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 366274 - 366222
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
366222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 365979 - 366030
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtc |
366030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 9028 - 8977
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
8977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 8734 - 8783
Alignment:
| Q |
185 |
ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
8783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 75355 - 75410
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
75355 |
tttaggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtc |
75410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 75768 - 75713
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
75768 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
75713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 148282 - 148231
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
148231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 5208 - 5257
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 5228 - 5277
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 4081 - 4028
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
4081 |
taggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 82708 - 82655
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
82708 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
82655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 82340 - 82392
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
82392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8546 - 8598
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
8598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 50075 - 50027
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
50027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 54814 - 54866
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
54866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 55176 - 55128
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
55128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 2664 - 2609
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
2664 |
tttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtc |
2609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4312 - 4261
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtc |
4261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 234
Target Start/End: Original strand, 4020 - 4060
Alignment:
| Q |
194 |
ggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
4020 |
ggttttagtccctacaaatatgcctcgttttggttttagtc |
4060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34931 - 34982
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| ||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtc |
34982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 18047 - 17992
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||||||| |||| |||||| |||||||||| ||||||| |
|
|
| T |
18047 |
tttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtc |
17992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12182 - 12233
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtc |
12233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 12536 - 12485
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
12485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 94055 - 94105
Alignment:
| Q |
181 |
taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
94055 |
taggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
184 |
gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||| |||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
| Q |
186 |
taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt |
233 |
Q |
| |
|
||||||| |||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16724 - 16775
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtc |
16775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 17966 - 17915
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||| ||||| |||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtc |
17915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35088 - 35033
Alignment:
| Q |
179 |
tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||||||| |||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
35088 |
tttaggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtc |
35033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2883 - 2832
Alignment:
| Q |
183 |
ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||||| ||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtc |
2832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 7265 - 7216
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta |
231 |
Q |
| |
|
||||||||||| | |||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22056 - 22004
Alignment:
| Q |
182 |
aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc |
234 |
Q |
| |
|
||||||||||| |||||| ||| || ||||| || |||||||||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtc |
22004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University