View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13663_low_2 (Length: 399)

Name: NF13663_low_2
Description: NF13663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13663_low_2
NF13663_low_2
[»] chr6 (126 HSPs)
chr6 (21-182)||(6182497-6182656)
chr6 (322-383)||(6181252-6181313)
chr6 (180-234)||(25431803-25431857)
chr6 (182-234)||(30928680-30928732)
chr6 (179-234)||(6412214-6412269)
chr6 (179-234)||(12176592-12176647)
chr6 (182-237)||(12757609-12757664)
chr6 (179-234)||(22543667-22543722)
chr6 (181-235)||(8170099-8170153)
chr6 (184-234)||(23770162-23770212)
chr6 (179-232)||(317808-317861)
chr6 (181-234)||(7156109-7156162)
chr6 (181-234)||(10910913-10910966)
chr6 (182-231)||(23502492-23502541)
chr6 (181-234)||(24692928-24692981)
chr6 (182-234)||(3276303-3276355)
chr6 (182-234)||(3968644-3968696)
chr6 (182-234)||(9896586-9896638)
chr6 (182-234)||(11448536-11448588)
chr6 (182-234)||(15076153-15076205)
chr6 (182-234)||(19690392-19690444)
chr6 (182-234)||(21385250-21385302)
chr6 (182-234)||(24274080-24274132)
chr6 (182-234)||(33801692-33801744)
chr6 (183-234)||(494405-494456)
chr6 (184-231)||(494704-494751)
chr6 (179-234)||(1890401-1890456)
chr6 (179-234)||(15962023-15962078)
chr6 (183-234)||(15962338-15962389)
chr6 (182-233)||(17765008-17765059)
chr6 (179-234)||(21994352-21994407)
chr6 (183-234)||(24901239-24901290)
chr6 (183-234)||(34582529-34582580)
chr6 (180-234)||(1214945-1214999)
chr6 (180-234)||(14655376-14655430)
chr6 (180-234)||(18024324-18024378)
chr6 (179-233)||(19321081-19321135)
chr6 (184-234)||(31166871-31166921)
chr6 (180-234)||(34582841-34582895)
chr6 (181-234)||(318046-318099)
chr6 (181-234)||(1007458-1007511)
chr6 (181-234)||(2615870-2615923)
chr6 (181-234)||(3414385-3414438)
chr6 (181-234)||(3968958-3969011)
chr6 (181-234)||(8680773-8680826)
chr6 (181-234)||(12419706-12419759)
chr6 (181-234)||(12419887-12419940)
chr6 (181-234)||(21993785-21993838)
chr6 (181-234)||(22543352-22543405)
chr6 (181-234)||(25137306-25137359)
chr6 (182-231)||(26375692-26375741)
chr6 (181-234)||(32885671-32885724)
chr6 (182-234)||(3356141-3356193)
chr6 (186-234)||(3356447-3356495)
chr6 (182-234)||(3414701-3414753)
chr6 (185-233)||(6591392-6591440)
chr6 (182-234)||(7155796-7155848)
chr6 (182-234)||(8681065-8681117)
chr6 (186-234)||(10091039-10091087)
chr6 (182-234)||(14656209-14656261)
chr6 (183-231)||(19296359-19296407)
chr6 (181-233)||(20467668-20467720)
chr6 (182-234)||(21995063-21995115)
chr6 (182-234)||(22792848-22792900)
chr6 (182-234)||(22822600-22822652)
chr6 (182-234)||(25136993-25137045)
chr6 (186-234)||(26375994-26376042)
chr6 (182-234)||(31398490-31398542)
chr6 (182-234)||(33131799-33131851)
chr6 (187-234)||(543365-543412)
chr6 (179-234)||(1007120-1007175)
chr6 (179-234)||(6564893-6564947)
chr6 (183-234)||(10910629-10910680)
chr6 (182-233)||(12299090-12299141)
chr6 (179-234)||(12612308-12612363)
chr6 (179-234)||(14428646-14428701)
chr6 (179-233)||(15116669-15116721)
chr6 (183-234)||(17771911-17771962)
chr6 (179-234)||(19129469-19129524)
chr6 (182-233)||(22822306-22822357)
chr6 (182-233)||(24273827-24273878)
chr6 (179-234)||(25121445-25121500)
chr6 (183-234)||(30239293-30239344)
chr6 (183-234)||(30928993-30929044)
chr6 (183-234)||(31167149-31167200)
chr6 (183-234)||(31198615-31198666)
chr6 (185-234)||(5286900-5286949)
chr6 (181-234)||(7324141-7324194)
chr6 (185-234)||(13617531-13617580)
chr6 (181-234)||(15722608-15722661)
chr6 (181-234)||(21147402-21147455)
chr6 (184-237)||(23628799-23628852)
chr6 (181-234)||(25121182-25121234)
chr6 (181-233)||(777992-778044)
chr6 (182-234)||(2373178-2373230)
chr6 (182-230)||(2616193-2616241)
chr6 (182-234)||(6412528-6412580)
chr6 (182-234)||(6468309-6468361)
chr6 (182-230)||(6591114-6591162)
chr6 (182-234)||(11449118-11449170)
chr6 (181-233)||(11925983-11926035)
chr6 (186-234)||(12298825-12298873)
chr6 (182-234)||(13150699-13150751)
chr6 (182-234)||(13268108-13268160)
chr6 (182-234)||(21385533-21385585)
chr6 (182-230)||(23502236-23502284)
chr6 (180-224)||(23770398-23770442)
chr6 (182-234)||(33808619-33808671)
chr6 (186-234)||(34990264-34990312)
chr6 (196-234)||(6564595-6564633)
chr6 (196-234)||(19275185-19275223)
chr6 (185-231)||(19320769-19320815)
chr6 (184-234)||(31276289-31276339)
chr6 (184-234)||(34989962-34990012)
chr6 (185-234)||(9896280-9896329)
chr6 (179-234)||(13617765-13617817)
chr6 (185-234)||(14428899-14428948)
chr6 (181-234)||(19129334-19129387)
chr6 (182-234)||(777676-777728)
chr6 (182-234)||(1214695-1214747)
chr6 (206-234)||(7323891-7323919)
chr6 (182-234)||(17765324-17765376)
chr6 (186-234)||(18024014-18024062)
chr6 (182-234)||(19296107-19296159)
chr6 (186-234)||(20467354-20467402)
chr6 (184-228)||(27764914-27764958)
[»] scaffold0166 (1 HSPs)
scaffold0166 (181-234)||(24370-24423)
[»] chr5 (149 HSPs)
chr5 (181-234)||(24781987-24782040)
chr5 (181-234)||(36577720-36577773)
chr5 (182-234)||(26133362-26133414)
chr5 (179-231)||(31037693-31037745)
chr5 (179-234)||(5950172-5950227)
chr5 (179-234)||(14318041-14318096)
chr5 (179-234)||(29692740-29692795)
chr5 (179-234)||(29875674-29875729)
chr5 (180-234)||(4203719-4203773)
chr5 (179-233)||(5614480-5614534)
chr5 (180-234)||(18046297-18046351)
chr5 (183-233)||(29366899-29366949)
chr5 (181-234)||(3850548-3850601)
chr5 (181-234)||(5917124-5917177)
chr5 (181-234)||(10744003-10744056)
chr5 (181-234)||(19685015-19685068)
chr5 (181-234)||(20690731-20690784)
chr5 (181-234)||(30800492-30800545)
chr5 (181-234)||(30800799-30800852)
chr5 (179-232)||(35877003-35877056)
chr5 (182-234)||(1381246-1381298)
chr5 (182-234)||(2217493-2217545)
chr5 (182-234)||(2217803-2217855)
chr5 (177-233)||(4203450-4203506)
chr5 (182-234)||(5614165-5614217)
chr5 (182-234)||(7075571-7075623)
chr5 (182-234)||(10743723-10743775)
chr5 (182-234)||(13990844-13990896)
chr5 (182-234)||(16038376-16038428)
chr5 (182-234)||(18046037-18046089)
chr5 (182-234)||(18258476-18258528)
chr5 (182-234)||(18633598-18633650)
chr5 (182-234)||(19565466-19565518)
chr5 (182-234)||(21124912-21124964)
chr5 (181-233)||(23381948-23382000)
chr5 (182-234)||(28863509-28863561)
chr5 (182-234)||(29172835-29172887)
chr5 (182-234)||(35167114-35167166)
chr5 (182-234)||(36578032-36578084)
chr5 (182-234)||(38496731-38496783)
chr5 (183-234)||(45138-45189)
chr5 (175-234)||(1104850-1104909)
chr5 (179-234)||(1105097-1105152)
chr5 (183-234)||(2032889-2032940)
chr5 (179-234)||(10409275-10409330)
chr5 (179-234)||(19565780-19565835)
chr5 (183-234)||(28550827-28550878)
chr5 (183-234)||(28863787-28863838)
chr5 (183-234)||(30888160-30888211)
chr5 (183-234)||(33335975-33336026)
chr5 (179-234)||(34125303-34125358)
chr5 (179-234)||(35166107-35166162)
chr5 (183-234)||(35928407-35928458)
chr5 (179-234)||(39379559-39379614)
chr5 (183-234)||(40029446-40029497)
chr5 (181-231)||(25561951-25562001)
chr5 (184-234)||(29172524-29172574)
chr5 (180-234)||(37271356-37271410)
chr5 (183-233)||(38962806-38962856)
chr5 (185-234)||(6912806-6912855)
chr5 (181-234)||(24443693-24443746)
chr5 (185-234)||(27850323-27850372)
chr5 (182-231)||(40029140-40029189)
chr5 (181-234)||(40167957-40168010)
chr5 (181-234)||(42207240-42207293)
chr5 (182-234)||(293827-293879)
chr5 (182-234)||(1381560-1381612)
chr5 (182-234)||(4736491-4736543)
chr5 (182-234)||(5917409-5917461)
chr5 (183-231)||(6118451-6118499)
chr5 (182-234)||(10408927-10408979)
chr5 (182-234)||(11799407-11799459)
chr5 (182-234)||(15635656-15635708)
chr5 (183-231)||(18633913-18633961)
chr5 (182-234)||(19685329-19685381)
chr5 (182-234)||(20660947-20660999)
chr5 (185-233)||(35609587-35609635)
chr5 (182-234)||(35928063-35928115)
chr5 (182-234)||(37271655-37271707)
chr5 (182-234)||(38170513-38170565)
chr5 (182-234)||(38786158-38786210)
chr5 (182-234)||(40167785-40167837)
chr5 (182-234)||(40764414-40764466)
chr5 (183-234)||(2636669-2636720)
chr5 (183-234)||(6912497-6912548)
chr5 (181-232)||(17070814-17070865)
chr5 (183-234)||(23382246-23382297)
chr5 (183-234)||(25561705-25561756)
chr5 (183-234)||(26133183-26133234)
chr5 (182-233)||(29151801-29151852)
chr5 (183-234)||(42553642-42553693)
chr5 (184-234)||(2636942-2636992)
chr5 (182-232)||(35166910-35166960)
chr5 (183-233)||(36973353-36973403)
chr5 (181-234)||(3851278-3851331)
chr5 (182-231)||(9179872-9179921)
chr5 (185-234)||(16038689-16038738)
chr5 (185-238)||(16616370-16616423)
chr5 (180-233)||(25779112-25779165)
chr5 (181-234)||(39379237-39379290)
chr5 (179-227)||(4736201-4736249)
chr5 (182-234)||(9179592-9179644)
chr5 (186-234)||(9532484-9532532)
chr5 (182-234)||(11799128-11799180)
chr5 (186-234)||(15635379-15635427)
chr5 (182-234)||(18258161-18258213)
chr5 (182-234)||(20416359-20416411)
chr5 (186-234)||(20417965-20418013)
chr5 (182-234)||(20683746-20683798)
chr5 (186-234)||(20985728-20985776)
chr5 (182-234)||(20986038-20986090)
chr5 (182-234)||(24443379-24443431)
chr5 (186-234)||(27916713-27916761)
chr5 (182-234)||(28213372-28213424)
chr5 (182-234)||(29693039-29693091)
chr5 (182-234)||(29875399-29875451)
chr5 (179-231)||(32108804-32108856)
chr5 (182-234)||(34125581-34125633)
chr5 (182-234)||(35876687-35876739)
chr5 (182-234)||(40764729-40764781)
chr5 (183-231)||(42994068-42994116)
chr5 (183-230)||(3850299-3850346)
chr5 (183-234)||(15916286-15916337)
chr5 (182-233)||(18286691-18286742)
chr5 (183-234)||(21050862-21050913)
chr5 (182-233)||(28871944-28871995)
chr5 (183-234)||(29151516-29151567)
chr5 (183-234)||(36973659-36973710)
chr5 (182-229)||(38182041-38182088)
chr5 (182-229)||(38189043-38189090)
chr5 (182-229)||(38209267-38209314)
chr5 (182-229)||(38216268-38216315)
chr5 (183-233)||(5103951-5104001)
chr5 (196-234)||(9588560-9588598)
chr5 (181-231)||(18286426-18286476)
chr5 (184-234)||(22551268-22551318)
chr5 (196-234)||(31602221-31602259)
chr5 (185-231)||(38452348-38452394)
chr5 (186-231)||(45456-45501)
chr5 (181-234)||(12144905-12144958)
chr5 (185-230)||(12145136-12145181)
chr5 (182-223)||(17070534-17070575)
chr5 (205-234)||(26071565-26071594)
chr5 (185-234)||(42207522-42207570)
chr5 (182-234)||(6953948-6954000)
chr5 (181-233)||(10830527-10830579)
chr5 (182-234)||(26071290-26071342)
chr5 (186-234)||(28108111-28108159)
chr5 (186-234)||(42596766-42596814)
[»] chr1 (172 HSPs)
chr1 (180-237)||(48609540-48609597)
chr1 (179-234)||(19622651-19622706)
chr1 (179-234)||(21391092-21391147)
chr1 (180-234)||(13260270-13260324)
chr1 (182-234)||(6567445-6567497)
chr1 (182-234)||(14007488-14007540)
chr1 (181-233)||(41358613-41358665)
chr1 (182-234)||(45290456-45290508)
chr1 (182-241)||(18473537-18473596)
chr1 (183-234)||(26191683-26191734)
chr1 (183-234)||(26442563-26442614)
chr1 (182-233)||(32626528-32626579)
chr1 (179-234)||(35005693-35005748)
chr1 (179-234)||(45380268-45380323)
chr1 (180-234)||(990328-990382)
chr1 (180-234)||(8140431-8140485)
chr1 (180-234)||(10887547-10887601)
chr1 (181-234)||(11822314-11822367)
chr1 (181-234)||(13259986-13260039)
chr1 (181-234)||(13770487-13770540)
chr1 (181-234)||(18473270-18473323)
chr1 (181-234)||(22919682-22919735)
chr1 (183-232)||(22953507-22953556)
chr1 (181-234)||(39747784-39747837)
chr1 (182-234)||(1810926-1810978)
chr1 (182-234)||(3247197-3247249)
chr1 (182-234)||(11822003-11822055)
chr1 (182-234)||(12360917-12360969)
chr1 (182-234)||(15526311-15526363)
chr1 (182-234)||(18302336-18302388)
chr1 (182-234)||(19720711-19720763)
chr1 (182-234)||(26061955-26062007)
chr1 (182-234)||(29072496-29072548)
chr1 (182-234)||(30322928-30322980)
chr1 (182-234)||(32728998-32729050)
chr1 (182-234)||(33000618-33000670)
chr1 (182-234)||(33379887-33379939)
chr1 (182-234)||(34002889-34002941)
chr1 (182-234)||(41358368-41358420)
chr1 (182-234)||(41881092-41881144)
chr1 (182-234)||(45368489-45368541)
chr1 (182-234)||(48609235-48609287)
chr1 (183-234)||(7001846-7001897)
chr1 (179-234)||(7867125-7867180)
chr1 (183-234)||(10631164-10631215)
chr1 (179-234)||(10887229-10887284)
chr1 (186-233)||(18899842-18899889)
chr1 (179-234)||(22919926-22919981)
chr1 (183-234)||(24977778-24977829)
chr1 (179-230)||(33067344-33067395)
chr1 (183-234)||(35056530-35056581)
chr1 (182-233)||(35307714-35307765)
chr1 (183-234)||(35308060-35308111)
chr1 (179-234)||(39303670-39303725)
chr1 (183-234)||(40718110-40718161)
chr1 (179-234)||(45290769-45290824)
chr1 (180-231)||(45638846-45638897)
chr1 (183-234)||(46868526-46868577)
chr1 (179-234)||(50429158-50429213)
chr1 (184-234)||(3753214-3753264)
chr1 (180-234)||(4789305-4789359)
chr1 (182-232)||(24654118-24654168)
chr1 (184-234)||(27521577-27521627)
chr1 (180-234)||(32454243-32454297)
chr1 (184-234)||(44641079-44641129)
chr1 (181-234)||(7819052-7819105)
chr1 (181-234)||(21383102-21383155)
chr1 (183-232)||(24649350-24649399)
chr1 (181-234)||(34808195-34808248)
chr1 (181-234)||(42482977-42483030)
chr1 (181-234)||(47819230-47819283)
chr1 (181-234)||(48955712-48955765)
chr1 (181-234)||(50799128-50799181)
chr1 (182-234)||(990087-990139)
chr1 (182-234)||(3679625-3679677)
chr1 (182-234)||(3753521-3753573)
chr1 (186-234)||(7350426-7350474)
chr1 (182-234)||(10631477-10631529)
chr1 (183-231)||(12322922-12322970)
chr1 (182-234)||(12361010-12361062)
chr1 (182-234)||(15211510-15211562)
chr1 (182-234)||(16083046-16083098)
chr1 (182-234)||(17984332-17984384)
chr1 (186-234)||(18900082-18900130)
chr1 (182-234)||(19622966-19623018)
chr1 (182-234)||(24507792-24507844)
chr1 (182-234)||(26442848-26442900)
chr1 (182-234)||(29688377-29688429)
chr1 (182-234)||(31258338-31258390)
chr1 (182-234)||(33045639-33045691)
chr1 (182-234)||(35005443-35005495)
chr1 (186-234)||(38150851-38150899)
chr1 (182-234)||(38164244-38164296)
chr1 (182-234)||(47819545-47819597)
chr1 (182-234)||(52254182-52254234)
chr1 (179-234)||(3247511-3247566)
chr1 (183-234)||(12158690-12158741)
chr1 (179-234)||(15516578-15516633)
chr1 (183-234)||(17984650-17984701)
chr1 (179-234)||(24649609-24649664)
chr1 (183-234)||(24653802-24653853)
chr1 (183-234)||(26191359-26191410)
chr1 (183-234)||(29072811-29072862)
chr1 (179-234)||(30323242-30323297)
chr1 (183-234)||(31060787-31060838)
chr1 (183-234)||(37545628-37545679)
chr1 (183-234)||(38151161-38151212)
chr1 (183-234)||(44641381-44641432)
chr1 (183-234)||(48956015-48956066)
chr1 (183-234)||(52254428-52254479)
chr1 (184-234)||(4323829-4323879)
chr1 (182-232)||(4360577-4360627)
chr1 (184-234)||(15058419-15058469)
chr1 (185-231)||(17130035-17130081)
chr1 (179-237)||(26142416-26142474)
chr1 (184-234)||(32420099-32420149)
chr1 (184-234)||(44157696-44157746)
chr1 (184-233)||(7818783-7818832)
chr1 (181-234)||(16026887-16026940)
chr1 (181-234)||(22674201-22674254)
chr1 (185-234)||(26207280-26207329)
chr1 (181-234)||(26324583-26324636)
chr1 (181-234)||(26324896-26324949)
chr1 (181-234)||(35056843-35056896)
chr1 (185-234)||(45368798-45368847)
chr1 (182-231)||(49073690-49073739)
chr1 (182-231)||(50428872-50428921)
chr1 (186-234)||(7350685-7350733)
chr1 (182-234)||(7867306-7867358)
chr1 (182-234)||(8140748-8140800)
chr1 (183-231)||(25658014-25658062)
chr1 (182-234)||(31061100-31061152)
chr1 (186-234)||(31258651-31258699)
chr1 (182-234)||(33234545-33234597)
chr1 (181-225)||(36912851-36912895)
chr1 (182-230)||(37624745-37624793)
chr1 (186-234)||(38163934-38163982)
chr1 (182-234)||(39747473-39747524)
chr1 (182-234)||(44157991-44158043)
chr1 (183-234)||(3679935-3679986)
chr1 (186-237)||(8364619-8364670)
chr1 (179-230)||(8364869-8364920)
chr1 (182-233)||(15058716-15058767)
chr1 (186-233)||(15335245-15335292)
chr1 (182-237)||(16060595-16060649)
chr1 (183-234)||(16060834-16060885)
chr1 (182-225)||(18079618-18079661)
chr1 (183-234)||(20948755-20948806)
chr1 (183-234)||(24507479-24507530)
chr1 (186-233)||(26062208-26062255)
chr1 (183-234)||(33000305-33000356)
chr1 (179-234)||(33045351-33045406)
chr1 (184-231)||(33067682-33067729)
chr1 (179-234)||(37624976-37625031)
chr1 (183-234)||(38136930-38136981)
chr1 (181-234)||(41739072-41739122)
chr1 (183-234)||(45380585-45380636)
chr1 (183-234)||(45638580-45638631)
chr1 (188-234)||(2939934-2939980)
chr1 (181-231)||(15334915-15334965)
chr1 (200-234)||(18302070-18302104)
chr1 (184-234)||(18928091-18928141)
chr1 (182-234)||(292860-292910)
chr1 (186-231)||(4360299-4360343)
chr1 (181-234)||(4565285-4565338)
chr1 (181-234)||(28507407-28507460)
chr1 (205-234)||(32035458-32035487)
chr1 (185-234)||(46183686-46183735)
chr1 (182-234)||(18079397-18079449)
chr1 (186-234)||(19721023-19721071)
chr1 (182-230)||(34002634-34002682)
chr1 (186-230)||(39025112-39025156)
[»] scaffold0326 (4 HSPs)
scaffold0326 (179-234)||(4037-4092)
scaffold0326 (179-234)||(19219-19274)
scaffold0326 (182-234)||(4237-4289)
scaffold0326 (182-234)||(19419-19471)
[»] chr7 (163 HSPs)
chr7 (179-234)||(39832902-39832957)
chr7 (182-234)||(44344738-44344790)
chr7 (177-233)||(48359025-48359081)
chr7 (183-234)||(13769774-13769825)
chr7 (183-234)||(19561399-19561450)
chr7 (179-234)||(25988381-25988436)
chr7 (183-234)||(35210464-35210515)
chr7 (179-234)||(35838286-35838341)
chr7 (179-234)||(46759654-46759709)
chr7 (180-234)||(23816667-23816721)
chr7 (180-234)||(30709593-30709647)
chr7 (181-234)||(1614557-1614610)
chr7 (181-234)||(17999670-17999723)
chr7 (181-234)||(19783813-19783866)
chr7 (182-234)||(6108333-6108385)
chr7 (182-234)||(8144294-8144346)
chr7 (182-234)||(12894351-12894403)
chr7 (182-234)||(19757747-19757799)
chr7 (182-234)||(23399925-23399977)
chr7 (182-234)||(25092159-25092211)
chr7 (182-234)||(27458398-27458450)
chr7 (182-234)||(28911855-28911907)
chr7 (182-234)||(35837923-35837975)
chr7 (182-234)||(44509003-44509055)
chr7 (183-234)||(1006835-1006886)
chr7 (183-234)||(1974009-1974060)
chr7 (179-234)||(3975787-3975842)
chr7 (183-234)||(7431951-7432002)
chr7 (179-234)||(17854145-17854200)
chr7 (179-234)||(20388270-20388325)
chr7 (179-234)||(23399608-23399663)
chr7 (179-234)||(23676128-23676183)
chr7 (183-234)||(25547439-25547490)
chr7 (187-234)||(37372441-37372488)
chr7 (182-233)||(37372854-37372905)
chr7 (183-234)||(44403198-44403249)
chr7 (183-234)||(44508720-44508771)
chr7 (183-233)||(19561154-19561204)
chr7 (180-234)||(31310362-31310416)
chr7 (180-234)||(32189339-32189393)
chr7 (180-234)||(39719591-39719645)
chr7 (184-234)||(43300613-43300663)
chr7 (181-234)||(8144607-8144660)
chr7 (182-231)||(8555751-8555800)
chr7 (184-233)||(18022368-18022417)
chr7 (181-234)||(18022653-18022706)
chr7 (181-234)||(23676401-23676454)
chr7 (181-234)||(26878020-26878073)
chr7 (181-234)||(28911575-28911628)
chr7 (181-234)||(29198301-29198354)
chr7 (181-234)||(29198611-29198664)
chr7 (181-234)||(35015169-35015222)
chr7 (181-234)||(45671497-45671550)
chr7 (182-231)||(46648667-46648716)
chr7 (181-234)||(48192437-48192490)
chr7 (182-234)||(489021-489073)
chr7 (182-234)||(1614853-1614905)
chr7 (182-234)||(3975548-3975600)
chr7 (182-234)||(5234153-5234205)
chr7 (182-234)||(6509207-6509259)
chr7 (182-234)||(6509419-6509471)
chr7 (182-234)||(9659638-9659690)
chr7 (182-234)||(14543709-14543761)
chr7 (182-234)||(21223697-21223749)
chr7 (182-234)||(25988698-25988750)
chr7 (182-234)||(26877677-26877729)
chr7 (182-234)||(30223460-30223512)
chr7 (186-234)||(31503732-31503780)
chr7 (182-234)||(39438978-39439030)
chr7 (182-234)||(44568639-44568691)
chr7 (181-233)||(45021806-45021858)
chr7 (179-231)||(45073310-45073362)
chr7 (182-234)||(45073590-45073642)
chr7 (182-234)||(45228867-45228919)
chr7 (182-234)||(46828943-46828995)
chr7 (183-234)||(5308323-5308374)
chr7 (179-234)||(5354764-5354819)
chr7 (183-234)||(10358317-10358368)
chr7 (182-233)||(13770031-13770082)
chr7 (183-234)||(16853538-16853589)
chr7 (183-230)||(17999465-17999512)
chr7 (182-233)||(23816984-23817035)
chr7 (179-234)||(35104244-35104299)
chr7 (183-234)||(39833185-39833236)
chr7 (179-234)||(41054185-41054240)
chr7 (183-234)||(41364884-41364935)
chr7 (183-234)||(46304333-46304384)
chr7 (183-234)||(46759891-46759942)
chr7 (184-234)||(6079810-6079860)
chr7 (180-234)||(35665874-35665928)
chr7 (180-234)||(39438738-39438792)
chr7 (181-234)||(9659353-9659406)
chr7 (181-234)||(10357999-10358052)
chr7 (181-234)||(19465930-19465982)
chr7 (181-234)||(21554702-21554755)
chr7 (182-231)||(34878077-34878126)
chr7 (182-234)||(1559654-1559706)
chr7 (181-233)||(3807862-3807914)
chr7 (182-234)||(5233807-5233859)
chr7 (182-234)||(14738953-14739005)
chr7 (186-234)||(18891514-18891562)
chr7 (183-235)||(18927039-18927091)
chr7 (182-234)||(25092497-25092549)
chr7 (181-233)||(25547251-25547303)
chr7 (186-230)||(28529162-28529206)
chr7 (182-234)||(30223744-30223796)
chr7 (186-234)||(30352563-30352611)
chr7 (183-231)||(31732101-31732149)
chr7 (186-234)||(34877777-34877825)
chr7 (182-234)||(35104077-35104129)
chr7 (186-234)||(37953000-37953048)
chr7 (182-234)||(39520397-39520449)
chr7 (182-234)||(44402959-44403011)
chr7 (182-234)||(44568325-44568377)
chr7 (182-234)||(44958455-44958507)
chr7 (183-234)||(45021494-45021546)
chr7 (181-233)||(45671212-45671264)
chr7 (182-234)||(46304085-46304137)
chr7 (186-234)||(48192260-48192308)
chr7 (182-234)||(48852443-48852495)
chr7 (183-230)||(6589021-6589068)
chr7 (187-234)||(6954862-6954909)
chr7 (179-234)||(11767224-11767279)
chr7 (184-231)||(18311581-18311628)
chr7 (183-234)||(21223405-21223456)
chr7 (183-234)||(21554393-21554444)
chr7 (183-234)||(24717481-24717532)
chr7 (183-234)||(27037593-27037644)
chr7 (183-234)||(30352853-30352904)
chr7 (182-229)||(31310633-31310680)
chr7 (183-234)||(35469880-35469931)
chr7 (183-234)||(39719353-39719404)
chr7 (183-234)||(46829261-46829312)
chr7 (196-234)||(3808068-3808106)
chr7 (181-235)||(5355065-5355119)
chr7 (181-231)||(28262711-28262761)
chr7 (182-232)||(31732402-31732452)
chr7 (184-234)||(37527371-37527421)
chr7 (196-234)||(38186709-38186747)
chr7 (179-233)||(38486474-38486528)
chr7 (182-231)||(1559342-1559391)
chr7 (185-234)||(6847068-6847117)
chr7 (181-234)||(6892209-6892262)
chr7 (181-234)||(12932732-12932785)
chr7 (185-234)||(37952671-37952720)
chr7 (184-233)||(41365164-41365213)
chr7 (185-234)||(43058752-43058801)
chr7 (182-231)||(44344456-44344505)
chr7 (189-229)||(488720-488760)
chr7 (194-234)||(1271548-1271588)
chr7 (182-234)||(2945794-2945846)
chr7 (182-234)||(5308636-5308687)
chr7 (186-234)||(6589223-6589271)
chr7 (179-231)||(8555603-8555655)
chr7 (186-230)||(11766920-11766964)
chr7 (182-234)||(16940761-16940813)
chr7 (186-234)||(16941001-16941049)
chr7 (186-234)||(30709328-30709376)
chr7 (183-231)||(32189076-32189124)
chr7 (179-235)||(38486738-38486794)
chr7 (186-234)||(39520679-39520727)
chr7 (182-234)||(41053841-41053893)
chr7 (182-234)||(48854019-48854071)
[»] chr4 (180 HSPs)
chr4 (182-241)||(24474905-24474964)
chr4 (179-234)||(46088009-46088064)
chr4 (179-233)||(45593536-45593590)
chr4 (181-234)||(9289264-9289317)
chr4 (181-234)||(13479560-13479613)
chr4 (178-234)||(13631223-13631279)
chr4 (182-234)||(22099861-22099913)
chr4 (182-234)||(29380859-29380911)
chr4 (182-234)||(34361802-34361854)
chr4 (182-241)||(32208541-32208600)
chr4 (179-234)||(35464014-35464069)
chr4 (183-234)||(50714514-50714565)
chr4 (179-233)||(32365090-32365144)
chr4 (180-234)||(35763644-35763698)
chr4 (180-234)||(51708690-51708744)
chr4 (180-234)||(52430049-52430103)
chr4 (173-234)||(5882542-5882602)
chr4 (181-234)||(9289588-9289641)
chr4 (181-234)||(22584285-22584338)
chr4 (181-234)||(29420486-29420539)
chr4 (181-234)||(35119560-35119613)
chr4 (181-234)||(41346167-41346220)
chr4 (181-234)||(52441761-52441814)
chr4 (181-234)||(53716919-53716972)
chr4 (182-234)||(13064414-13064466)
chr4 (182-234)||(14791755-14791807)
chr4 (182-234)||(16712640-16712692)
chr4 (182-234)||(18205155-18205207)
chr4 (185-233)||(18205473-18205521)
chr4 (182-234)||(25423923-25423975)
chr4 (182-234)||(25424261-25424313)
chr4 (182-234)||(32365432-32365484)
chr4 (182-234)||(36701999-36702051)
chr4 (182-234)||(41345852-41345904)
chr4 (182-234)||(43231087-43231139)
chr4 (182-234)||(46115728-46115780)
chr4 (182-234)||(46128862-46128914)
chr4 (182-234)||(52017504-52017556)
chr4 (182-234)||(52017819-52017871)
chr4 (182-234)||(52442041-52442093)
chr4 (181-233)||(53915997-53916049)
chr4 (179-234)||(4279018-4279073)
chr4 (179-234)||(13064155-13064210)
chr4 (183-234)||(13073759-13073810)
chr4 (184-231)||(13479273-13479320)
chr4 (179-234)||(14488136-14488191)
chr4 (184-235)||(15555586-15555637)
chr4 (183-234)||(22099543-22099594)
chr4 (182-233)||(23778963-23779014)
chr4 (183-234)||(35415582-35415633)
chr4 (174-233)||(42823767-42823826)
chr4 (182-233)||(45505844-45505895)
chr4 (183-234)||(53717123-53717174)
chr4 (181-234)||(123532-123585)
chr4 (181-234)||(11693070-11693123)
chr4 (181-230)||(12152446-12152495)
chr4 (185-234)||(19903604-19903653)
chr4 (181-234)||(23245544-23245597)
chr4 (181-234)||(26412188-26412241)
chr4 (176-241)||(32208843-32208908)
chr4 (181-234)||(41619897-41619950)
chr4 (185-234)||(43368467-43368516)
chr4 (181-234)||(51545918-51545971)
chr4 (182-234)||(2034804-2034856)
chr4 (182-234)||(2180219-2180271)
chr4 (182-234)||(5052533-5052585)
chr4 (182-234)||(5827922-5827974)
chr4 (182-234)||(6827545-6827597)
chr4 (182-234)||(6827823-6827875)
chr4 (182-234)||(8760603-8760655)
chr4 (182-234)||(8760730-8760782)
chr4 (182-234)||(13530662-13530714)
chr4 (182-234)||(13631548-13631600)
chr4 (186-234)||(15555506-15555554)
chr4 (182-234)||(23779174-23779226)
chr4 (182-234)||(24774044-24774096)
chr4 (182-234)||(28809129-28809181)
chr4 (182-230)||(29380667-29380715)
chr4 (182-230)||(29463866-29463914)
chr4 (182-234)||(29499181-29499233)
chr4 (182-234)||(30046741-30046793)
chr4 (182-234)||(30061082-30061134)
chr4 (182-234)||(31812162-31812214)
chr4 (186-234)||(38054549-38054597)
chr4 (182-234)||(41921033-41921085)
chr4 (182-234)||(42848026-42848078)
chr4 (182-234)||(43231338-43231390)
chr4 (182-234)||(44925484-44925536)
chr4 (182-234)||(45505599-45505651)
chr4 (182-234)||(46292600-46292652)
chr4 (182-234)||(51545628-51545680)
chr4 (182-234)||(51708976-51709028)
chr4 (186-234)||(54208774-54208822)
chr4 (182-234)||(55072388-55072440)
chr4 (182-233)||(2322382-2322433)
chr4 (183-234)||(4279284-4279335)
chr4 (183-234)||(5827655-5827706)
chr4 (179-234)||(12791923-12791978)
chr4 (179-234)||(13074074-13074129)
chr4 (183-234)||(13764613-13764664)
chr4 (179-234)||(14594202-14594257)
chr4 (183-234)||(19321808-19321859)
chr4 (179-234)||(22584556-22584611)
chr4 (183-234)||(23245231-23245282)
chr4 (183-234)||(26412533-26412584)
chr4 (183-234)||(27008084-27008135)
chr4 (183-234)||(28809011-28809062)
chr4 (183-234)||(31560644-31560695)
chr4 (183-234)||(35464331-35464382)
chr4 (183-234)||(42848340-42848391)
chr4 (183-234)||(46115414-46115465)
chr4 (183-234)||(46128548-46128599)
chr4 (183-234)||(50714240-50714291)
chr4 (183-234)||(53308017-53308068)
chr4 (184-234)||(11285504-11285554)
chr4 (188-234)||(27008355-27008401)
chr4 (184-234)||(36050289-36050339)
chr4 (180-234)||(47023054-47023108)
chr4 (184-234)||(47136120-47136170)
chr4 (183-233)||(47274180-47274230)
chr4 (181-231)||(51738135-51738185)
chr4 (181-231)||(55072664-55072714)
chr4 (181-230)||(4211559-4211608)
chr4 (185-234)||(9445951-9446000)
chr4 (181-234)||(13530377-13530430)
chr4 (181-230)||(14487800-14487849)
chr4 (185-234)||(18831127-18831176)
chr4 (181-234)||(20291984-20292037)
chr4 (181-234)||(28448832-28448885)
chr4 (185-234)||(30564835-30564884)
chr4 (181-234)||(34355232-34355285)
chr4 (181-234)||(35415297-35415350)
chr4 (181-234)||(35763904-35763957)
chr4 (182-231)||(52543421-52543470)
chr4 (181-234)||(53915681-53915734)
chr4 (186-234)||(5797484-5797532)
chr4 (182-234)||(13764756-13764808)
chr4 (182-234)||(24474599-24474650)
chr4 (182-234)||(26314281-26314333)
chr4 (182-234)||(27427871-27427922)
chr4 (186-234)||(29499495-29499543)
chr4 (182-234)||(31182453-31182505)
chr4 (181-233)||(31370802-31370854)
chr4 (182-234)||(31811924-31811976)
chr4 (182-234)||(36054099-36054151)
chr4 (182-234)||(41620205-41620257)
chr4 (182-234)||(45474545-45474597)
chr4 (186-234)||(47022743-47022791)
chr4 (182-234)||(54903424-54903476)
chr4 (183-234)||(2180521-2180572)
chr4 (183-234)||(8191340-8191391)
chr4 (183-230)||(9446276-9446323)
chr4 (183-234)||(25358489-25358540)
chr4 (183-234)||(41324839-41324890)
chr4 (183-234)||(42824040-42824091)
chr4 (183-230)||(46292392-46292439)
chr4 (183-234)||(55482417-55482468)
chr4 (188-234)||(123847-123893)
chr4 (181-231)||(5797772-5797822)
chr4 (184-234)||(6353587-6353637)
chr4 (194-228)||(25358464-25358498)
chr4 (184-234)||(36702312-36702362)
chr4 (184-234)||(44925794-44925844)
chr4 (180-234)||(45593225-45593279)
chr4 (184-233)||(2322094-2322143)
chr4 (182-231)||(8904885-8904934)
chr4 (181-234)||(12152152-12152205)
chr4 (185-234)||(16712331-16712380)
chr4 (182-231)||(28449166-28449215)
chr4 (181-234)||(30060767-30060820)
chr4 (185-234)||(35420652-35420701)
chr4 (181-234)||(41439785-41439838)
chr4 (188-233)||(47532622-47532667)
chr4 (185-234)||(51830891-51830940)
chr4 (186-241)||(5202929-5202985)
chr4 (186-234)||(14791502-14791550)
chr4 (186-234)||(28197230-28197278)
chr4 (183-231)||(29463610-29463658)
chr4 (182-234)||(31560330-31560382)
chr4 (182-234)||(35119291-35119343)
[»] chr2 (162 HSPs)
chr2 (179-234)||(40786456-40786511)
chr2 (180-234)||(38639409-38639463)
chr2 (181-234)||(10671890-10671943)
chr2 (181-234)||(11788365-11788418)
chr2 (182-234)||(19183781-19183833)
chr2 (183-234)||(5790848-5790899)
chr2 (183-234)||(11713485-11713536)
chr2 (179-234)||(20131313-20131368)
chr2 (179-238)||(23989834-23989893)
chr2 (183-234)||(26813866-26813917)
chr2 (183-234)||(36622250-36622301)
chr2 (179-234)||(44985933-44985988)
chr2 (183-233)||(9195054-9195104)
chr2 (181-234)||(13215058-13215111)
chr2 (181-234)||(26239109-26239162)
chr2 (181-234)||(40302288-40302341)
chr2 (181-234)||(41451835-41451888)
chr2 (181-234)||(43788856-43788909)
chr2 (181-234)||(44559060-44559113)
chr2 (182-234)||(4424134-4424186)
chr2 (183-231)||(10375021-10375069)
chr2 (182-234)||(11713794-11713846)
chr2 (182-234)||(16900155-16900207)
chr2 (182-234)||(16993546-16993598)
chr2 (182-234)||(17541725-17541777)
chr2 (182-234)||(19184100-19184152)
chr2 (182-234)||(22881612-22881664)
chr2 (182-234)||(24483840-24483892)
chr2 (182-234)||(25705084-25705136)
chr2 (182-234)||(26814178-26814230)
chr2 (182-234)||(31644840-31644892)
chr2 (182-234)||(33576066-33576118)
chr2 (182-234)||(33732861-33732913)
chr2 (182-234)||(37271738-37271790)
chr2 (182-234)||(37272051-37272103)
chr2 (182-234)||(38980202-38980254)
chr2 (182-234)||(41693673-41693725)
chr2 (179-234)||(17912445-17912500)
chr2 (179-234)||(24358612-24358667)
chr2 (179-234)||(25705398-25705453)
chr2 (179-234)||(33575748-33575803)
chr2 (183-234)||(42695868-42695919)
chr2 (179-234)||(43597150-43597205)
chr2 (179-234)||(44985617-44985672)
chr2 (180-234)||(10664981-10665035)
chr2 (184-234)||(20939274-20939324)
chr2 (186-236)||(23990143-23990193)
chr2 (180-234)||(43592043-43592097)
chr2 (181-234)||(9195155-9195208)
chr2 (184-233)||(10374775-10374824)
chr2 (181-234)||(10671628-10671681)
chr2 (181-234)||(16523274-16523327)
chr2 (181-234)||(27311018-27311071)
chr2 (189-234)||(35155298-35155343)
chr2 (185-234)||(44559358-44559407)
chr2 (182-231)||(45442315-45442364)
chr2 (182-234)||(2265346-2265398)
chr2 (182-234)||(2481506-2481558)
chr2 (182-234)||(3837932-3837984)
chr2 (182-234)||(4423894-4423946)
chr2 (182-234)||(8046328-8046380)
chr2 (182-234)||(14003691-14003743)
chr2 (182-234)||(15842772-15842824)
chr2 (182-234)||(16522990-16523042)
chr2 (182-234)||(16673410-16673462)
chr2 (182-234)||(17302092-17302144)
chr2 (182-234)||(17541381-17541433)
chr2 (182-234)||(25954114-25954166)
chr2 (186-234)||(26238816-26238864)
chr2 (182-234)||(29859821-29859873)
chr2 (183-231)||(33733193-33733241)
chr2 (182-234)||(37228732-37228784)
chr2 (182-234)||(38731828-38731880)
chr2 (186-234)||(42358702-42358750)
chr2 (182-234)||(43597448-43597500)
chr2 (182-234)||(44073756-44073808)
chr2 (182-234)||(44994010-44994062)
chr2 (182-234)||(45442645-45442697)
chr2 (183-234)||(146639-146690)
chr2 (179-234)||(1138308-1138363)
chr2 (183-234)||(3671141-3671192)
chr2 (183-234)||(4042839-4042890)
chr2 (183-234)||(4794130-4794181)
chr2 (183-234)||(5334751-5334802)
chr2 (183-234)||(5334989-5335040)
chr2 (183-234)||(5790558-5790609)
chr2 (179-234)||(7814686-7814741)
chr2 (183-234)||(8046597-8046648)
chr2 (180-235)||(13215313-13215368)
chr2 (179-234)||(14003405-14003460)
chr2 (183-234)||(20131630-20131681)
chr2 (182-229)||(27310875-27310922)
chr2 (187-234)||(36806845-36806892)
chr2 (182-233)||(36815785-36815836)
chr2 (183-234)||(41693952-41694003)
chr2 (180-234)||(146323-146377)
chr2 (180-234)||(3671000-3671054)
chr2 (184-234)||(3838213-3838263)
chr2 (180-234)||(15842458-15842512)
chr2 (180-234)||(16673720-16673774)
chr2 (180-230)||(20658362-20658412)
chr2 (184-234)||(29865222-29865272)
chr2 (181-231)||(32691311-32691361)
chr2 (181-234)||(3832586-3832639)
chr2 (188-233)||(11943543-11943588)
chr2 (181-234)||(20658059-20658112)
chr2 (181-234)||(26709694-26709747)
chr2 (181-234)||(29865460-29865513)
chr2 (181-234)||(30215820-30215873)
chr2 (183-232)||(34964110-34964159)
chr2 (182-234)||(2481192-2481244)
chr2 (182-234)||(4042609-4042661)
chr2 (182-234)||(7814245-7814297)
chr2 (186-234)||(17912760-17912808)
chr2 (182-234)||(18113088-18113140)
chr2 (182-234)||(24358894-24358946)
chr2 (186-234)||(29859490-29859538)
chr2 (182-234)||(30215421-30215473)
chr2 (183-231)||(31226029-31226077)
chr2 (185-233)||(36622534-36622582)
chr2 (183-234)||(38979889-38979941)
chr2 (182-234)||(40301974-40302026)
chr2 (182-234)||(43789141-43789193)
chr2 (186-233)||(5006610-5006657)
chr2 (182-233)||(10665244-10665295)
chr2 (183-234)||(12835325-12835376)
chr2 (186-233)||(19831511-19831558)
chr2 (183-234)||(23732039-23732090)
chr2 (182-229)||(23732282-23732329)
chr2 (183-234)||(27109073-27109124)
chr2 (182-233)||(31225714-31225765)
chr2 (183-234)||(34317798-34317849)
chr2 (183-234)||(41791261-41791312)
chr2 (188-234)||(4794422-4794468)
chr2 (184-234)||(4842865-4842915)
chr2 (184-234)||(24483401-24483451)
chr2 (182-224)||(32691594-32691636)
chr2 (183-233)||(40124966-40125016)
chr2 (184-234)||(42696152-42696202)
chr2 (196-234)||(43710394-43710432)
chr2 (185-231)||(44993806-44993851)
chr2 (185-230)||(1137983-1138028)
chr2 (185-234)||(1497894-1497943)
chr2 (181-234)||(13850520-13850573)
chr2 (205-234)||(14393078-14393107)
chr2 (205-234)||(22881917-22881946)
chr2 (181-234)||(26707871-26707924)
chr2 (180-233)||(29182392-29182445)
chr2 (181-234)||(31909428-31909480)
chr2 (181-234)||(36815486-36815539)
chr2 (182-231)||(37911072-37911121)
chr2 (185-234)||(41791020-41791069)
chr2 (182-234)||(3172019-3172071)
chr2 (182-234)||(3172481-3172533)
chr2 (186-234)||(16968555-16968603)
chr2 (182-234)||(31326201-31326253)
chr2 (182-234)||(32476094-32476146)
chr2 (194-230)||(33576039-33576075)
chr2 (182-234)||(35155568-35155620)
chr2 (182-234)||(43592329-43592381)
chr2 (182-234)||(43672267-43672319)
chr2 (182-234)||(43710657-43710709)
[»] chr8 (151 HSPs)
chr8 (179-241)||(24954952-24955014)
chr8 (181-234)||(8094477-8094530)
chr8 (181-234)||(29158352-29158405)
chr8 (182-234)||(7272419-7272471)
chr8 (182-234)||(14238750-14238802)
chr8 (181-233)||(19494117-19494169)
chr8 (179-234)||(3512215-3512270)
chr8 (179-234)||(10337115-10337170)
chr8 (182-233)||(16789074-16789125)
chr8 (182-233)||(25131110-25131161)
chr8 (181-234)||(1526121-1526174)
chr8 (181-234)||(35097326-35097379)
chr8 (181-234)||(35346947-35347000)
chr8 (181-234)||(40492958-40493011)
chr8 (182-234)||(1525808-1525860)
chr8 (182-234)||(7420229-7420281)
chr8 (182-234)||(7420539-7420591)
chr8 (182-234)||(8298924-8298976)
chr8 (181-233)||(9496339-9496391)
chr8 (182-234)||(11019519-11019571)
chr8 (182-234)||(14239029-14239081)
chr8 (182-234)||(16643993-16644045)
chr8 (182-234)||(19494362-19494414)
chr8 (182-234)||(22650463-22650515)
chr8 (182-234)||(22917563-22917615)
chr8 (182-234)||(24187846-24187898)
chr8 (181-233)||(25600228-25600280)
chr8 (182-234)||(27341540-27341592)
chr8 (182-234)||(32418317-32418369)
chr8 (182-234)||(32725906-32725958)
chr8 (182-234)||(43477162-43477214)
chr8 (183-234)||(1778564-1778615)
chr8 (183-234)||(7185953-7186004)
chr8 (183-234)||(8298587-8298638)
chr8 (179-234)||(11019806-11019861)
chr8 (179-234)||(11976685-11976740)
chr8 (183-234)||(14489022-14489073)
chr8 (182-233)||(14495068-14495119)
chr8 (183-234)||(15719656-15719707)
chr8 (179-234)||(16643657-16643712)
chr8 (183-234)||(16789318-16789369)
chr8 (179-234)||(28346707-28346762)
chr8 (179-234)||(33526361-33526416)
chr8 (183-234)||(34963613-34963664)
chr8 (183-234)||(35346629-35346680)
chr8 (182-233)||(38930301-38930352)
chr8 (183-234)||(42133103-42133154)
chr8 (180-234)||(4473701-4473755)
chr8 (180-234)||(4710169-4710223)
chr8 (185-231)||(10776150-10776196)
chr8 (183-233)||(10776449-10776499)
chr8 (183-233)||(23939547-23939597)
chr8 (181-234)||(8094790-8094843)
chr8 (181-234)||(17073805-17073858)
chr8 (181-234)||(17574412-17574465)
chr8 (181-234)||(18549199-18549252)
chr8 (185-234)||(18549522-18549571)
chr8 (181-234)||(28258190-28258243)
chr8 (181-234)||(32726220-32726273)
chr8 (181-234)||(33636320-33636373)
chr8 (185-234)||(43727383-43727431)
chr8 (186-234)||(1685117-1685165)
chr8 (182-234)||(2728231-2728283)
chr8 (182-234)||(4017249-4017301)
chr8 (183-231)||(4375692-4375740)
chr8 (182-234)||(11976372-11976424)
chr8 (179-231)||(13155203-13155255)
chr8 (186-234)||(13232201-13232249)
chr8 (182-234)||(20984145-20984197)
chr8 (182-234)||(20984459-20984511)
chr8 (182-234)||(28346393-28346445)
chr8 (182-234)||(29488059-29488111)
chr8 (182-234)||(34963299-34963351)
chr8 (179-231)||(35345569-35345621)
chr8 (182-234)||(37536085-37536137)
chr8 (186-234)||(40844484-40844532)
chr8 (183-231)||(42132864-42132912)
chr8 (183-234)||(2728546-2728597)
chr8 (179-234)||(3511902-3511957)
chr8 (184-231)||(4016906-4016953)
chr8 (183-234)||(7272700-7272751)
chr8 (183-234)||(7326370-7326421)
chr8 (179-234)||(10540445-10540500)
chr8 (183-234)||(10873229-10873280)
chr8 (179-234)||(20278006-20278061)
chr8 (179-234)||(21064633-21064688)
chr8 (183-234)||(25131396-25131447)
chr8 (179-234)||(27117749-27117804)
chr8 (183-234)||(29158618-29158669)
chr8 (182-229)||(30337171-30337218)
chr8 (179-234)||(32040071-32040126)
chr8 (183-234)||(35097641-35097692)
chr8 (182-233)||(40066496-40066547)
chr8 (183-234)||(40066769-40066820)
chr8 (183-234)||(40844156-40844207)
chr8 (183-234)||(42430069-42430120)
chr8 (184-234)||(6146517-6146567)
chr8 (184-234)||(6146898-6146948)
chr8 (180-234)||(6469616-6469670)
chr8 (180-234)||(10337398-10337452)
chr8 (184-234)||(24090437-24090487)
chr8 (183-232)||(1408005-1408054)
chr8 (181-234)||(5357421-5357474)
chr8 (180-233)||(6469277-6469330)
chr8 (181-234)||(7326084-7326137)
chr8 (181-234)||(19962993-19963046)
chr8 (182-231)||(21125718-21125767)
chr8 (181-234)||(28398984-28399037)
chr8 (182-231)||(38930616-38930665)
chr8 (182-234)||(1408302-1408354)
chr8 (186-234)||(2811730-2811778)
chr8 (179-235)||(4375959-4376014)
chr8 (182-234)||(4473993-4474045)
chr8 (182-234)||(9175011-9175063)
chr8 (182-234)||(9496672-9496724)
chr8 (182-234)||(10540731-10540783)
chr8 (183-231)||(10755480-10755528)
chr8 (182-234)||(10872914-10872966)
chr8 (182-234)||(14488715-14488767)
chr8 (182-234)||(14496815-14496867)
chr8 (182-234)||(20277691-20277743)
chr8 (182-234)||(21064318-21064370)
chr8 (182-234)||(24187568-24187620)
chr8 (182-234)||(24815017-24815069)
chr8 (182-234)||(25600546-25600598)
chr8 (182-234)||(28323848-28323900)
chr8 (182-234)||(28324130-28324182)
chr8 (183-234)||(1162909-1162960)
chr8 (183-234)||(4621303-4621354)
chr8 (179-234)||(9175320-9175375)
chr8 (184-234)||(14495339-14495389)
chr8 (183-234)||(29487750-29487801)
chr8 (183-234)||(33526052-33526103)
chr8 (184-231)||(36044744-36044791)
chr8 (183-234)||(37536368-37536419)
chr8 (183-234)||(44998212-44998263)
chr8 (183-233)||(13232512-13232562)
chr8 (185-231)||(13779151-13779197)
chr8 (180-234)||(21125970-21126024)
chr8 (205-234)||(14848139-14848168)
chr8 (182-239)||(27117920-27117977)
chr8 (181-230)||(35115592-35115641)
chr8 (181-234)||(35143793-35143846)
chr8 (183-228)||(40493112-40493157)
chr8 (195-231)||(1778881-1778917)
chr8 (206-234)||(2356197-2356225)
chr8 (206-234)||(4709929-4709957)
chr8 (184-232)||(13779483-13779531)
chr8 (182-234)||(28497254-28497306)
chr8 (186-234)||(28497568-28497616)
chr8 (186-234)||(29991918-29991966)
[»] chr3 (179 HSPs)
chr3 (179-241)||(3151746-3151808)
chr3 (180-234)||(34238595-34238649)
chr3 (182-234)||(22008525-22008577)
chr3 (182-234)||(22016043-22016095)
chr3 (181-233)||(30130156-30130208)
chr3 (182-234)||(39288572-39288624)
chr3 (182-234)||(39436717-39436769)
chr3 (179-234)||(3152060-3152115)
chr3 (179-234)||(3830465-3830520)
chr3 (179-234)||(12740903-12740958)
chr3 (179-234)||(22155925-22155980)
chr3 (179-234)||(31869905-31869960)
chr3 (179-234)||(51550395-51550450)
chr3 (183-234)||(53701612-53701663)
chr3 (179-233)||(21159767-21159821)
chr3 (182-231)||(4814539-4814588)
chr3 (181-234)||(28427243-28427296)
chr3 (181-234)||(29446155-29446208)
chr3 (181-234)||(29490692-29490745)
chr3 (181-234)||(37506865-37506918)
chr3 (181-234)||(47336530-47336583)
chr3 (181-234)||(54608812-54608865)
chr3 (182-234)||(474043-474095)
chr3 (181-233)||(474358-474410)
chr3 (182-234)||(4513262-4513314)
chr3 (182-234)||(4513569-4513621)
chr3 (182-234)||(4814848-4814899)
chr3 (182-234)||(4950036-4950088)
chr3 (182-234)||(12741220-12741272)
chr3 (182-234)||(20612847-20612899)
chr3 (182-234)||(21159452-21159504)
chr3 (182-234)||(28427557-28427609)
chr3 (182-234)||(29525104-29525156)
chr3 (182-234)||(37507171-37507223)
chr3 (182-234)||(39437058-39437110)
chr3 (181-233)||(46901102-46901154)
chr3 (182-234)||(51834607-51834659)
chr3 (183-234)||(4034717-4034768)
chr3 (183-234)||(9863353-9863404)
chr3 (183-234)||(10976978-10977029)
chr3 (179-234)||(15979650-15979705)
chr3 (183-234)||(25710819-25710870)
chr3 (183-234)||(26090027-26090078)
chr3 (179-234)||(39288847-39288902)
chr3 (183-234)||(40169603-40169654)
chr3 (179-234)||(51834891-51834946)
chr3 (180-234)||(3830131-3830185)
chr3 (184-234)||(22156242-22156292)
chr3 (180-234)||(25710507-25710561)
chr3 (180-234)||(28552332-28552386)
chr3 (179-233)||(29955616-29955670)
chr3 (179-233)||(30004771-30004825)
chr3 (179-233)||(30128280-30128334)
chr3 (183-233)||(43441270-43441320)
chr3 (180-233)||(7518396-7518449)
chr3 (173-234)||(8510478-8510539)
chr3 (181-234)||(9262104-9262157)
chr3 (185-234)||(50196301-50196350)
chr3 (181-234)||(51550080-51550133)
chr3 (182-234)||(3387553-3387605)
chr3 (182-234)||(5345638-5345690)
chr3 (182-234)||(13584316-13584368)
chr3 (182-234)||(14633838-14633890)
chr3 (182-234)||(20611019-20611071)
chr3 (182-234)||(25615974-25616026)
chr3 (182-234)||(26799887-26799939)
chr3 (181-233)||(28942523-28942575)
chr3 (182-234)||(28942854-28942906)
chr3 (182-234)||(30130453-30130505)
chr3 (182-234)||(30268504-30268556)
chr3 (182-234)||(30552427-30552479)
chr3 (182-234)||(31480135-31480187)
chr3 (186-234)||(35569085-35569133)
chr3 (182-234)||(40169343-40169395)
chr3 (182-234)||(43440494-43440546)
chr3 (181-233)||(45002019-45002071)
chr3 (182-234)||(45002334-45002386)
chr3 (186-234)||(45161116-45161164)
chr3 (182-234)||(45320928-45320980)
chr3 (182-234)||(46186720-46186772)
chr3 (182-234)||(46751270-46751322)
chr3 (182-234)||(47005153-47005205)
chr3 (182-234)||(47114486-47114538)
chr3 (182-234)||(51500634-51500686)
chr3 (182-234)||(51759818-51759870)
chr3 (182-234)||(52342532-52342584)
chr3 (182-234)||(54608517-54608569)
chr3 (183-234)||(8510214-8510265)
chr3 (179-234)||(13514526-13514581)
chr3 (185-232)||(14633547-14633594)
chr3 (183-234)||(15016388-15016439)
chr3 (183-234)||(16123139-16123190)
chr3 (183-234)||(22008839-22008890)
chr3 (179-234)||(28452143-28452198)
chr3 (183-234)||(29445954-29446005)
chr3 (183-234)||(30424628-30424679)
chr3 (182-233)||(35177254-35177305)
chr3 (183-234)||(40370538-40370589)
chr3 (179-234)||(40545560-40545615)
chr3 (179-234)||(47005468-47005523)
chr3 (183-234)||(49323782-49323833)
chr3 (182-237)||(53113442-53113497)
chr3 (184-234)||(3361767-3361817)
chr3 (180-234)||(32119217-32119271)
chr3 (183-233)||(44802282-44802332)
chr3 (181-234)||(275442-275495)
chr3 (181-234)||(9603627-9603680)
chr3 (181-234)||(28552019-28552072)
chr3 (185-234)||(29955300-29955349)
chr3 (185-234)||(30004454-30004503)
chr3 (181-234)||(30034421-30034474)
chr3 (181-234)||(30106169-30106222)
chr3 (185-234)||(31869596-31869645)
chr3 (181-234)||(36672961-36673014)
chr3 (182-231)||(40979662-40979711)
chr3 (181-234)||(46622078-46622131)
chr3 (181-234)||(49324095-49324148)
chr3 (181-234)||(50196606-50196659)
chr3 (181-234)||(51500396-51500449)
chr3 (182-234)||(1721401-1721453)
chr3 (186-234)||(3387268-3387316)
chr3 (182-234)||(7518089-7518141)
chr3 (186-234)||(8940474-8940522)
chr3 (182-234)||(10977290-10977342)
chr3 (182-234)||(12673643-12673695)
chr3 (182-234)||(14772210-14772262)
chr3 (182-234)||(15286155-15286207)
chr3 (182-234)||(19656540-19656592)
chr3 (182-234)||(19844530-19844582)
chr3 (186-234)||(20757403-20757451)
chr3 (182-234)||(32119533-32119585)
chr3 (182-234)||(34238864-34238916)
chr3 (182-234)||(38232240-38232292)
chr3 (182-234)||(43441552-43441604)
chr3 (182-234)||(47336227-47336279)
chr3 (182-234)||(48924189-48924241)
chr3 (184-232)||(51760069-51760117)
chr3 (179-231)||(52342191-52342243)
chr3 (179-234)||(863277-863332)
chr3 (179-234)||(1721085-1721140)
chr3 (183-234)||(9261789-9261840)
chr3 (183-234)||(15979338-15979389)
chr3 (183-222)||(18175791-18175830)
chr3 (183-234)||(26089730-26089781)
chr3 (183-234)||(30426176-30426226)
chr3 (183-234)||(31480449-31480500)
chr3 (185-232)||(35533281-35533328)
chr3 (186-233)||(45521786-45521833)
chr3 (183-234)||(50261885-50261936)
chr3 (183-233)||(4035003-4035053)
chr3 (184-234)||(9596759-9596809)
chr3 (181-231)||(9603871-9603921)
chr3 (184-234)||(11463233-11463283)
chr3 (182-232)||(21553888-21553938)
chr3 (184-234)||(25610079-25610129)
chr3 (181-231)||(27681634-27681684)
chr3 (180-234)||(28452325-28452379)
chr3 (180-234)||(30552144-30552197)
chr3 (183-233)||(40370285-40370335)
chr3 (196-234)||(43440736-43440774)
chr3 (185-231)||(45006201-45006247)
chr3 (184-234)||(46186410-46186460)
chr3 (181-234)||(7588316-7588369)
chr3 (181-234)||(9863045-9863097)
chr3 (181-234)||(20907406-20907459)
chr3 (181-234)||(35407739-35407792)
chr3 (186-234)||(863601-863649)
chr3 (185-233)||(2486581-2486629)
chr3 (186-234)||(4322138-4322186)
chr3 (182-234)||(9597044-9597096)
chr3 (194-230)||(25610024-25610060)
chr3 (182-234)||(29678023-29678075)
chr3 (182-234)||(29686543-29686595)
chr3 (182-234)||(35565507-35565559)
chr3 (183-231)||(39072165-39072213)
chr3 (186-234)||(40545788-40545836)
chr3 (186-234)||(45005889-45005937)
chr3 (186-234)||(47901803-47901851)
chr3 (183-234)||(49670751-49670803)
[»] scaffold0811 (2 HSPs)
scaffold0811 (182-234)||(1310-1362)
scaffold0811 (182-234)||(1593-1645)
[»] scaffold0370 (1 HSPs)
scaffold0370 (182-234)||(238-290)
[»] scaffold0337 (1 HSPs)
scaffold0337 (183-234)||(12525-12576)
[»] scaffold0179 (1 HSPs)
scaffold0179 (179-234)||(3240-3295)
[»] scaffold0160 (1 HSPs)
scaffold0160 (179-234)||(27313-27368)
[»] scaffold0065 (2 HSPs)
scaffold0065 (183-234)||(3532-3583)
scaffold0065 (182-234)||(3867-3919)
[»] scaffold0210 (2 HSPs)
scaffold0210 (181-234)||(14695-14748)
scaffold0210 (182-234)||(14961-15013)
[»] scaffold1001 (1 HSPs)
scaffold1001 (182-234)||(2777-2829)
[»] scaffold0060 (2 HSPs)
scaffold0060 (182-234)||(8329-8381)
scaffold0060 (182-234)||(8591-8643)
[»] scaffold0051 (2 HSPs)
scaffold0051 (182-234)||(5657-5709)
scaffold0051 (182-234)||(5398-5450)
[»] scaffold0016 (2 HSPs)
scaffold0016 (181-233)||(10465-10517)
scaffold0016 (183-234)||(10168-10219)
[»] scaffold0005 (3 HSPs)
scaffold0005 (182-234)||(47924-47976)
scaffold0005 (179-234)||(223121-223176)
scaffold0005 (186-234)||(48180-48228)
[»] scaffold0003 (2 HSPs)
scaffold0003 (182-234)||(366222-366274)
scaffold0003 (183-234)||(365979-366030)
[»] scaffold0535 (2 HSPs)
scaffold0535 (183-234)||(8977-9028)
scaffold0535 (185-234)||(8734-8783)
[»] scaffold0024 (2 HSPs)
scaffold0024 (179-234)||(75355-75410)
scaffold0024 (179-234)||(75713-75768)
[»] scaffold0001 (1 HSPs)
scaffold0001 (183-234)||(148231-148282)
[»] scaffold0712 (1 HSPs)
scaffold0712 (182-231)||(5208-5257)
[»] scaffold0709 (1 HSPs)
scaffold0709 (182-231)||(5228-5277)
[»] scaffold0078 (1 HSPs)
scaffold0078 (181-234)||(4028-4081)
[»] scaffold0026 (2 HSPs)
scaffold0026 (181-234)||(82655-82708)
scaffold0026 (182-234)||(82340-82392)
[»] scaffold0373 (1 HSPs)
scaffold0373 (182-234)||(8546-8598)
[»] scaffold0056 (3 HSPs)
scaffold0056 (186-234)||(50027-50075)
scaffold0056 (182-234)||(54814-54866)
scaffold0056 (186-234)||(55128-55176)
[»] scaffold0684 (1 HSPs)
scaffold0684 (179-234)||(2609-2664)
[»] scaffold0347 (2 HSPs)
scaffold0347 (183-234)||(4261-4312)
scaffold0347 (194-234)||(4020-4060)
[»] scaffold0159 (1 HSPs)
scaffold0159 (183-234)||(34931-34982)
[»] scaffold0123 (1 HSPs)
scaffold0123 (179-234)||(17992-18047)
[»] scaffold0021 (2 HSPs)
scaffold0021 (183-234)||(12182-12233)
scaffold0021 (183-234)||(12485-12536)
[»] scaffold0339 (1 HSPs)
scaffold0339 (183-233)||(3405-3455)
[»] scaffold0002 (2 HSPs)
scaffold0002 (181-231)||(94055-94105)
scaffold0002 (184-231)||(94282-94329)
[»] scaffold0578 (1 HSPs)
scaffold0578 (186-233)||(5020-5067)
[»] scaffold0119 (1 HSPs)
scaffold0119 (183-234)||(16724-16775)
[»] scaffold0105 (1 HSPs)
scaffold0105 (183-234)||(17915-17966)
[»] scaffold0085 (1 HSPs)
scaffold0085 (179-234)||(35033-35088)
[»] scaffold0007 (1 HSPs)
scaffold0007 (183-234)||(2832-2883)
[»] scaffold0472 (1 HSPs)
scaffold0472 (182-231)||(7216-7265)
[»] scaffold0176 (1 HSPs)
scaffold0176 (182-234)||(22004-22056)


Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 126)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 21 - 182
Target Start/End: Complemental strand, 6182656 - 6182497
Alignment:
21 acatccatctacatcaaatcaaacccaacaatctttcagcgtgtttgcaaagttcactaacatagtcaatatagttggtaaaataaagttggagagagag 120  Q
    |||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |||| | ||||||||||||||||||||||||  |||    
6182656 acatccatctacatcaaatcaaacccaacaatcttttagggcgtttgcaaagttcactaacattgtcagtgtagttggtaaaataaagttggaga--gag 6182559  T
121 atgaagttgttgggttaaatttggtatagatggactatagtaagattttgtggaaaagttta 182  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||    
6182558 atgaagttgtggggttaaatttggtatagatggactctagtaagattttgtggaaaagttta 6182497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 383
Target Start/End: Complemental strand, 6181313 - 6181252
Alignment:
322 ggtttatttctcttatttggtgcaaaagcattgtcattattttatatcacagatttttcttc 383  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
6181313 ggtttatttctcttattagatgcaaaagcattgtcattattttatatcacagatttttcttc 6181252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 25431857 - 25431803
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
25431857 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 25431803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30928680 - 30928732
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
30928680 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 30928732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 6412214 - 6412269
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
6412214 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 6412269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 12176647 - 12176592
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||    
12176647 tttaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 12176592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 12757609 - 12757664
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||    
12757609 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcact 12757664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 22543722 - 22543667
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
22543722 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 22543667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 8170153 - 8170099
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    |||||||||||| |||||| ||| |||||||||||||||||||||||||||||||    
8170153 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtca 8170099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 23770162 - 23770212
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||    
23770162 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 23770212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 317808 - 317861
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||    
317808 tttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag 317861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 7156162 - 7156109
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
7156162 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 7156109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 10910966 - 10910913
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
10910966 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 10910913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 23502541 - 23502492
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||    
23502541 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 23502492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 24692981 - 24692928
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
24692981 taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtc 24692928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3276355 - 3276303
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
3276355 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 3276303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3968644 - 3968696
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
3968644 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 3968696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9896638 - 9896586
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||||| |||||||||||||||    
9896638 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc 9896586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11448536 - 11448588
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||||||||||||||||||||||    
11448536 aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 11448588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15076205 - 15076153
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
15076205 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 15076153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19690392 - 19690444
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
19690392 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 19690444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21385250 - 21385302
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
21385250 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 21385302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24274132 - 24274080
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
24274132 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 24274080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33801744 - 33801692
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
33801744 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 33801692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 494405 - 494456
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
494405 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 494456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||    
494751 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 494704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1890456 - 1890401
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
1890456 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 1890401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 15962023 - 15962078
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
15962023 tttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 15962078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 15962389 - 15962338
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
15962389 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 15962338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||| ||| |||||||||||||||||||||||||||||    
17765008 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 17765059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 21994407 - 21994352
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
21994407 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 21994352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
24901239 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 24901290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34582529 - 34582580
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
34582529 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 34582580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 1214999 - 1214945
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
1214999 ttaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtc 1214945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 14655376 - 14655430
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
14655376 ttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 14655430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 18024378 - 18024324
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| |||||||||||||| |||||||||||||||    
18024378 ttaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc 18024324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 19321135 - 19321081
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||    
19321135 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 19321081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 31166871 - 31166921
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
31166871 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 31166921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 34582895 - 34582841
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||  ||||||||||||||||||    
34582895 ttaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc 34582841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 318099 - 318046
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| || |||||||||||| |||||||||||||||||    
318099 taggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtc 318046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 1007511 - 1007458
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
1007511 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 1007458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 2615870 - 2615923
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||  ||||||||||||||||||    
2615870 taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc 2615923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 3414385 - 3414438
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
3414385 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 3414438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3969011 - 3968958
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
3969011 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 3968958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 8680773 - 8680826
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
8680773 taggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtc 8680826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12419706 - 12419759
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
12419706 taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 12419759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 12419940 - 12419887
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
12419940 taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 12419887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21993785 - 21993838
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
21993785 taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtc 21993838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22543352 - 22543405
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
22543352 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 22543405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 25137359 - 25137306
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
25137359 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 25137306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 26375692 - 26375741
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| ||||||| || |||||||||||||||||||||||||||    
26375692 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta 26375741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 32885671 - 32885724
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
32885671 taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 32885724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3356141 - 3356193
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
3356141 aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc 3356193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 3356495 - 3356447
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
3356495 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 3356447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3414753 - 3414701
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||| ||||||||||||||||||||||||||    
3414753 aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc 3414701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| |||||||||  |||||||||||||||||||||||||||||    
6591440 ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt 6591392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7155796 - 7155848
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| ||||||||||| ||||||||||||||||||    
7155796 aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 7155848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8681117 - 8681065
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||||||||||    
8681117 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 8681065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 10091039 - 10091087
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| |||||||||||| |||||||||||||||||    
10091039 taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc 10091087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14656261 - 14656209
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| |||  |||||||||||||||||||||||||||||    
14656261 aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc 14656209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||    
19296407 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 19296359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 20467720 - 20467668
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| ||||||||||| |||||||||||||||||    
20467720 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 20467668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21995063 - 21995115
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||| ||||| ||||||||||||||||||    
21995063 aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtc 21995115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22792900 - 22792848
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||| ||||| ||||||||||| ||||||||||||||||||    
22792900 aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtc 22792848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22822652 - 22822600
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
22822652 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 22822600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25136993 - 25137045
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
25136993 aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtc 25137045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 26376042 - 26375994
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
26376042 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 26375994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31398542 - 31398490
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||||||| ||||||||||||||    
31398542 aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc 31398490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33131851 - 33131799
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
33131851 aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtc 33131799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 543365 - 543412
Alignment:
187 aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||||||||| ||||||||||| ||||||||||||||||||    
543365 aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 543412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 1007120 - 1007175
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
1007120 tttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 1007175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 6564947 - 6564893
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| || |||| ||| ||||||||||||||||||||||||||||||    
6564947 tttaggctaaaattgg-ttttggtccctgcaaatatgtctcgttttggttttagtc 6564893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10910629 - 10910680
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| || |||||||||||||||||||||||||||    
10910629 ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtc 10910680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 12299141 - 12299090
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||| ||| ||||||||||| |||||||||||||||||    
12299141 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 12299090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 12612363 - 12612308
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||| |||||| ||||||||||| |||||||| |||||||||    
12612363 tttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtc 12612308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14428646 - 14428701
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
14428646 tttaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 14428701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 15116669 - 15116721
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||||||| |||||||||  ||||||||||||||||||    
15116669 tttaggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt 15116721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 17771911 - 17771962
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||||||||||||    
17771911 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 17771962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 19129524 - 19129469
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||| ||| ||||||||||||| ||||||||||||||||    
19129524 tttaggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtc 19129469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||  |||||||||||||||||    
22822306 aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 24273827 - 24273878
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| |||||||||||  ||||||||||||||||    
24273827 aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 24273878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 25121500 - 25121445
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||  |||||||||||| |||||||||||||||||    
25121500 tttaggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtc 25121445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30239293 - 30239344
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||  ||||||||||||||||||||||||||||||    
30239293 ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtc 30239344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30929044 - 30928993
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
30929044 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 30928993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31167200 - 31167149
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
31167200 ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtc 31167149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 31198615 - 31198666
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
31198615 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc 31198666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 5286949 - 5286900
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
5286949 ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 5286900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 7324194 - 7324141
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||||||| |||||||||||  |||||||||||||||||    
7324194 taggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 7324141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 13617531 - 13617580
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
13617531 ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc 13617580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 15722608 - 15722661
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| |||  |||||||||||||||||||| ||||||||    
15722608 taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtc 15722661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21147402 - 21147455
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
21147402 taggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtc 21147455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 23628799 - 23628852
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||    
23628799 gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcact 23628852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 25121182 - 25121234
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
25121182 taggctaaaatatggttttcatc-ctgcaaatatgtctcgttttggttttagtc 25121234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| ||||||| || ||||||||||| |||||||| ||||||||    
778044 taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt 777992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2373178 - 2373230
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| || ||||||||| |||||    
2373178 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtc 2373230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||||||    
2616241 aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt 2616193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6412580 - 6412528
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
6412580 aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc 6412528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6468309 - 6468361
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  | |||||||||||||||    
6468309 aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtc 6468361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||| |||||||||| | ||||||||| ||||||||||||||    
6591114 aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt 6591162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11449170 - 11449118
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| |||||||||||| |||||    
11449170 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtc 11449118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 11926035 - 11925983
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| ||| ||||||||| |||||||||||||||    
11926035 taggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt 11925983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12298825 - 12298873
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| |||||||||||||||||||| |||||||||    
12298825 taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtc 12298873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13150751 - 13150699
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||| |||  | ||||||||||||||||||||||||||||||    
13150751 aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtc 13150699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 13268108 - 13268160
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||| ||||||||||    
13268108 aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtc 13268160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 21385585 - 21385533
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
21385585 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 21385533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||    
23502236 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 23502284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 23770442 - 23770398
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgtttt 224  Q
    ||||||||||||| |||||||||| ||||||||||| ||||||||    
23770442 ttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt 23770398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33808619 - 33808671
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||| ||||||| ||||||||| ||||||||    
33808619 aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtc 33808671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 34990312 - 34990264
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| |||||||||||  |||||||||||||||||    
34990312 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 34990264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 6564595 - 6564633
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||| ||||||||||||||||||||||||||||||    
6564595 ttttggtccctgcaaatatgtctcgttttggttttagtc 6564633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||| ||||||||||||||||||||||||||||||    
19275223 ttttggtccctgcaaatatgtctcgttttggttttagtc 19275185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||| |||||| ||| ||||||||||||||| |||||||||||    
19320769 ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta 19320815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 31276339 - 31276289
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||  ||||| ||| ||||||||||||||||||||| ||||||||    
31276339 gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtc 31276289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 34989962 - 34990012
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| | |||||||| ||||||||||| ||||||||| ||||||||    
34989962 gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtc 34990012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9896280 - 9896329
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||||| || ||||||||||||||| |||| |||||||||    
9896280 ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtc 9896329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 13617817 - 13617765
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||   ||||| ||| ||||||||||| ||||||||||||||||||    
13617817 tttaggctaaaat---gttttggtccctgcaaatatgcctcgttttggttttagtc 13617765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 14428948 - 14428899
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||||||||  ||||||||||  |||||||||||||||||    
14428948 ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc 14428899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19129334 - 19129387
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||| || ||| ||| ||||||||||| ||||||||||||||||||    
19129334 taggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtc 19129387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 777676 - 777728
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||  ||||||||||  ||||||||||||||||||    
777676 aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtc 777728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1214695 - 1214747
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||| ||| ||||||||||||| | ||||||||||||||    
1214695 aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtc 1214747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 234
Target Start/End: Original strand, 7323891 - 7323919
Alignment:
206 tgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||||||||||||||||||    
7323891 tgcaaatatgtctcgttttggttttagtc 7323919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 17765376 - 17765324
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||||||||||||  ||||||||    
17765376 aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtc 17765324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 18024014 - 18024062
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| |||  |||||||||| ||||||||||||||||||    
18024014 taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtc 18024062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19296107 - 19296159
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| | |||||||||| |||||||||||  |||||||| ||||||||    
19296107 aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtc 19296159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20467354 - 20467402
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||  ||||| ||| ||||||||||| ||||||||||||||||||    
20467354 taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtc 20467402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 184 - 228
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtt 228  Q
    ||||||||| |||||||||| || |||||||||||| ||||||||    
27764914 gctaaaatatggttttagtccctacaaatatgtctcattttggtt 27764958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 24370 - 24423
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
24370 taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtc 24423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 50; Significance: 2e-19; HSPs: 149)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 24781987 - 24782040
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
24781987 taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtc 24782040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 36577720 - 36577773
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
36577720 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 36577773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26133414 - 26133362
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
26133414 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 26133362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 31037745 - 31037693
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||||| |||||||||| |||||||||||||||||||||||||||    
31037745 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 31037693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 5950172 - 5950227
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
5950172 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 5950227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14318041 - 14318096
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||||||  |||||||||||||||||||||||||||||    
14318041 tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 14318096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 29692740 - 29692795
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
29692740 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 29692795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 29875729 - 29875674
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
29875729 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 29875674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 4203773 - 4203719
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
4203773 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 4203719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 5614534 - 5614480
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
5614534 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 5614480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 18046351 - 18046297
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
18046351 ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 18046297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 29366949 - 29366899
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||||    
29366949 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 29366899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3850601 - 3850548
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||| |||||||||| ||||||||||||||||||||||||||||||    
3850601 taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 3850548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 5917124 - 5917177
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
5917124 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 5917177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 10744056 - 10744003
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  |||||||||||||||||||||||||||||    
10744056 taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 10744003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19685015 - 19685068
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
19685015 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 19685068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 20690731 - 20690784
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
20690731 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 20690784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 30800492 - 30800545
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
30800492 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 30800545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30800852 - 30800799
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
30800852 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 30800799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 35877056 - 35877003
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||    
35877056 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag 35877003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1381246 - 1381298
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
1381246 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 1381298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2217493 - 2217545
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
2217493 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 2217545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2217855 - 2217803
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
2217855 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 2217803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 233
Target Start/End: Original strand, 4203450 - 4203506
Alignment:
177 agtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||| ||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
4203450 agttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 4203506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5614165 - 5614217
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
5614165 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 5614217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7075571 - 7075623
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
7075571 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 7075623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10743723 - 10743775
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
10743723 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 10743775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13990896 - 13990844
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
13990896 aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 13990844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16038376 - 16038428
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
16038376 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 16038428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18046037 - 18046089
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
18046037 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 18046089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 18258528 - 18258476
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
18258528 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 18258476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18633598 - 18633650
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
18633598 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 18633650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19565466 - 19565518
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
19565466 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 19565518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21124912 - 21124964
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
21124912 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 21124964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 23381948 - 23382000
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| |||||||||||||| ||||||||||||||    
23381948 taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt 23382000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28863509 - 28863561
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
28863509 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 28863561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29172887 - 29172835
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
29172887 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 29172835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 35167166 - 35167114
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
35167166 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 35167114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 36578084 - 36578032
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
36578084 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 36578032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 38496783 - 38496731
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||| |||||||||||||||||    
38496783 aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc 38496731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45138 - 45189
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
45138 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 45189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 175 - 234
Target Start/End: Original strand, 1104850 - 1104909
Alignment:
175 aaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
1104850 aaagtttaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc 1104909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1105152 - 1105097
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
1105152 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 1105097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2032940 - 2032889
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| || |||||||||| ||||||||||||||||||||||||||||||    
2032940 ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtc 2032889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 10409330 - 10409275
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
10409330 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 10409275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 19565835 - 19565780
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
19565835 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 19565780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 28550827 - 28550878
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
28550827 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 28550878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 28863838 - 28863787
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
28863838 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 28863787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30888160 - 30888211
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
30888160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 30888211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 33336026 - 33335975
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
33336026 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc 33335975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 34125303 - 34125358
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||  ||||||||| ||||||||||| ||||||||||||||||||    
34125303 tttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 34125358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35166162 - 35166107
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||| |||||||||| ||||||| ||||||||||||||||||||||    
35166162 tttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtc 35166107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35928458 - 35928407
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35928458 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35928407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 39379614 - 39379559
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
39379614 tttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 39379559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40029497 - 40029446
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
40029497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 40029446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||||||||| ||||||||||| |||||||||||||||    
25562001 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 25561951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29172524 - 29172574
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
29172524 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 29172574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 37271356 - 37271410
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
37271356 ttaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc 37271410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||||||| ||| |||||||||||||||||||||||||    
38962806 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt 38962856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 6912855 - 6912806
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| ||||||||||||||||||||||||||||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 6912806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 24443746 - 24443693
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
24443746 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24443693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 27850372 - 27850323
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| | |||||||| ||||||||||||||||||||||||||||||    
27850372 ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtc 27850323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 40029140 - 40029189
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| ||| |||||||||||||||||||||||    
40029140 aggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta 40029189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 40168010 - 40167957
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||  |||||||||  |||||||||||||||||||||||||||||    
40168010 taggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtc 40167957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 42207240 - 42207293
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  || ||||||||||||||||||||||||||    
42207240 taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtc 42207293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 293827 - 293879
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
293827 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 293879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1381612 - 1381560
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
1381612 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 1381560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4736543 - 4736491
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||| |||||||||||||||||    
4736543 aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 4736491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5917461 - 5917409
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
5917461 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 5917409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||    
6118499 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 6118451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10408927 - 10408979
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
10408927 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 10408979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11799459 - 11799407
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
11799459 aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtc 11799407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15635708 - 15635656
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| | ||||||||| ||||||||||||||||||    
15635708 aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc 15635656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||    
18633961 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 18633913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19685381 - 19685329
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
19685381 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 19685329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20660947 - 20660999
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
20660947 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 20660999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| |||||| ||| |||||||||||||||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35609587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35928063 - 35928115
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
35928063 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 35928115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37271707 - 37271655
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||| ||||||||    
37271707 aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtc 37271655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38170513 - 38170565
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
38170513 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 38170565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38786158 - 38786210
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
38786158 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 38786210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40167785 - 40167837
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| || |||||||||| ||||||||||| ||||||||||||||||||    
40167785 aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtc 40167837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40764414 - 40764466
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
40764414 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 40764466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||| ||||||||||||||||||||    
2636669 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc 2636720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 6912497 - 6912548
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
6912497 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 6912548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 181 - 232
Target Start/End: Complemental strand, 17070865 - 17070814
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||||||| |||||||||| || ||||||||||||||||| |||||||    
17070865 taggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag 17070814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 23382297 - 23382246
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| || |||||||||||||||    
23382297 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 23382246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 25561705 - 25561756
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||||||||||||    
25561705 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc 25561756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26133183 - 26133234
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| || |||||||| ||||||||||||||||||    
26133183 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc 26133234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 29151852 - 29151801
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||  ||||||||||| |||||||||||||||||    
29151852 aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt 29151801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||||||||||||||||||||||||||||||    
42553642 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 42553693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 2636992 - 2636942
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
2636992 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 2636942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||||||||    
35166910 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag 35166960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| ||| || ||||||||||||||||||||||||||    
36973353 ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt 36973403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3851331 - 3851278
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||  ||||||||||||||||| ||||||||    
3851331 taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtc 3851278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 9179921 - 9179872
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| ||||||||||  |||||||||| |||||||||||||||    
9179921 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta 9179872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 16038738 - 16038689
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| | |||||||| ||||||||||| ||||||||||||||||||    
16038738 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 16038689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 238
Target Start/End: Original strand, 16616370 - 16616423
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcacta 238  Q
    |||||||| |||||||||| ||||||||||| ||| |||| |||||||||||||    
16616370 ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtcacta 16616423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 25779165 - 25779112
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||||| |||||||||| |||||||||||  || |||||||||||||    
25779165 ttaggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagt 25779112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 39379237 - 39379290
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| | |||||||| ||||||||||| ||||||||||||||||||    
39379237 taggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 39379290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 4736201 - 4736249
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggt 227  Q
    |||||||||||||| |||||| |||  ||||||||||||||||||||||    
4736201 tttaggctaaaatatggttttggtctttgcaaatatgtctcgttttggt 4736249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 9179592 - 9179644
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  ||||||||||  |||||||||||||||||    
9179592 aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtc 9179644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 9532532 - 9532484
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||||||||  |||||||||| ||||||||||||||||||    
9532532 taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 9532484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11799128 - 11799180
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  | |||||||||||||||    
11799128 aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtc 11799180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15635379 - 15635427
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||||||||  ||||||||||||| |||||||||||||||    
15635379 taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtc 15635427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18258161 - 18258213
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
18258161 aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtc 18258213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20416359 - 20416411
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||||||| |||||||| ||||    
20416359 aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtc 20416411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 20418013 - 20417965
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||| |||| ||||||||||||||||||||| ||||||||    
20418013 taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtc 20417965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20683746 - 20683798
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||| ||||||||    
20683746 aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtc 20683798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20985728 - 20985776
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
20985728 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 20985776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 20986090 - 20986038
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
20986090 aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc 20986038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24443379 - 24443431
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
24443379 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 24443431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||||| || ||||||||||| ||||||||||||||||||    
27916761 taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc 27916713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28213372 - 28213424
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
28213372 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 28213424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29693091 - 29693039
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| |||||||||||  |||||||||||||||||    
29693091 aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc 29693039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29875399 - 29875451
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | ||||| || ||||||||||| ||||||||||||||||||    
29875399 aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtc 29875451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 32108804 - 32108856
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||||| |||||| ||| |||||||||||| ||||||| ||||||    
32108804 tttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta 32108856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34125633 - 34125581
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||| ||||||| ||| ||||||||||||||    
34125633 aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtc 34125581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35876687 - 35876739
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
35876687 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 35876739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 40764781 - 40764729
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
40764781 aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtc 40764729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| ||||||||| |||||    
42994068 ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta 42994116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||| |||||||||| |||||||| || ||||||||||||||    
3850299 ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt 3850346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15916286 - 15916337
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| | |||||| ||| ||||||||||||||| ||||||||||||||    
15916286 ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtc 15916337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||| | |||||||||| ||||||||||  |||||||||||||||||    
18286742 aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt 18286691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 21050913 - 21050862
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||| ||||||||    
21050913 ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtc 21050862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 28871995 - 28871944
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| || |||||| ||| ||||||||||| |||||||||||||||||    
28871995 aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagt 28871944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29151516 - 29151567
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||| ||||||||    
29151516 ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc 29151567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 36973710 - 36973659
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||| ||||||||||||||||| ||||||||    
36973710 ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtc 36973659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 38182088 - 38182041
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||| ||  |||||||||||||||||||||||||    
38182088 aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38182041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 38189043 - 38189090
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||| ||  |||||||||||||||||||||||||    
38189043 aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38189090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 38209314 - 38209267
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||| ||  |||||||||||||||||||||||||    
38209314 aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38209267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 38216268 - 38216315
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||| ||  |||||||||||||||||||||||||    
38216268 aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38216315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| ||  ||||||||||||||| |||||||||||||    
5104001 ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt 5103951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 9588598 - 9588560
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||| ||||||||||||||||||||||||||||||    
9588598 ttttggtccctgcaaatatgtctcgttttggttttagtc 9588560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||| ||||||| |||||||||  |||||||||||||| ||||||||||||    
18286426 taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta 18286476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 22551318 - 22551268
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||| |||||||| | |||||||||||||||    
22551318 gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtc 22551268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||| ||||||||||||||||||||||||||||||    
31602221 ttttggtccctgcaaatatgtctcgttttggttttagtc 31602259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||| |||||| ||| ||||||||||||||||||||| |||||    
38452394 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||| |||||| ||| |||||||||||| ||||||||||||||    
45501 taaaatatggttttggtccctgcaaatatgtttcgttttggtttta 45456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12144905 - 12144958
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||| ||||||| ||| ||||||||||||||    
12144905 taggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtc 12144958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||| |||||| ||| ||||||||||||||||||||| ||||    
12145181 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt 12145136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 223
Target Start/End: Original strand, 17070534 - 17070575
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttt 223  Q
    ||||||||||| |||||| ||| |||||||||||||||||||    
17070534 aggctaaaatatggttttggtccctgcaaatatgtctcgttt 17070575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 26071594 - 26071565
Alignment:
205 ctgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||||||||||||||||||    
26071594 ctgcaaatatgtctcgttttggttttagtc 26071565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 42207570 - 42207522
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| || |||||||| ||||||||||||||||||    
42207570 ctaaaatatggttttagtc-ctacaaatatgcctcgttttggttttagtc 42207522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6953948 - 6954000
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| ||||| ||||||| ||| |||||| ||||||||    
6953948 aggctaaaatatggttttaatcactacaaatatttcttgttttgattttagtc 6954000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 10830527 - 10830579
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| || |||||||| || ||||||||||||||    
10830527 taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagt 10830579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26071290 - 26071342
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||  ||| ||||||||||||||| ||||||||||||||    
26071290 aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtc 26071342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28108159 - 28108111
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| || |||||||| ||||||||||||||||||    
28108159 taaaatatggttttggtccctacaaatatgcctcgttttggttttagtc 28108111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 42596814 - 42596766
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
42596814 taaaatatggttttggtccctgcaaatatgactcgttttagttttagtc 42596766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 172)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 180 - 237
Target Start/End: Complemental strand, 48609597 - 48609540
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
48609597 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcact 48609540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 19622651 - 19622706
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
19622651 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 19622706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 21391092 - 21391147
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
21391092 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 21391147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 13260324 - 13260270
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
13260324 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 13260270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6567497 - 6567445
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
6567497 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 6567445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14007488 - 14007540
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
14007488 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 14007540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 41358665 - 41358613
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||||    
41358665 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 41358613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45290456 - 45290508
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
45290456 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 45290508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 18473596 - 18473537
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta 241  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||| ||||||    
18473596 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagta 18473537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26191734 - 26191683
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
26191734 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 26191683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26442563 - 26442614
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
26442563 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 26442614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 32626528 - 32626579
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||    
32626528 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 32626579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35005748 - 35005693
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
35005748 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 35005693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 45380268 - 45380323
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
45380268 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 45380323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 990382 - 990328
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
990382 ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 990328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 8140431 - 8140485
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
8140431 ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8140485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 10887601 - 10887547
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
10887601 ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 10887547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 11822367 - 11822314
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
11822367 taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtc 11822314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13259986 - 13260039
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
13259986 taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtc 13260039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13770487 - 13770540
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
13770487 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 13770540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 18473270 - 18473323
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
18473270 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 18473323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22919682 - 22919735
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
22919682 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 22919735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||    
22953556 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag 22953507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 39747837 - 39747784
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
39747837 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 39747784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1810926 - 1810978
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
1810926 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 1810978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3247197 - 3247249
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
3247197 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 3247249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11822003 - 11822055
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
11822003 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 11822055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12360969 - 12360917
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
12360969 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 12360917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15526363 - 15526311
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
15526363 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 15526311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 18302388 - 18302336
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
18302388 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 18302336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19720711 - 19720763
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
19720711 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 19720763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26061955 - 26062007
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
26061955 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 26062007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29072496 - 29072548
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
29072496 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 29072548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30322928 - 30322980
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
30322928 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 30322980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32729050 - 32728998
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
32729050 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 32728998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33000670 - 33000618
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
33000670 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 33000618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33379887 - 33379939
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
33379887 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 33379939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34002941 - 34002889
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||||| |||||||||||||||    
34002941 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc 34002889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41358368 - 41358420
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
41358368 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 41358420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41881092 - 41881144
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| || |||||||||||||||||||||||||||    
41881092 aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtc 41881144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45368489 - 45368541
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
45368489 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 45368541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 48609235 - 48609287
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| | ||||||||||||||||||||||||||||    
48609235 aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtc 48609287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7001897 - 7001846
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
7001897 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 7001846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 7867125 - 7867180
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||||||  ||||||||||||||||||| |||||||||    
7867125 tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc 7867180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10631164 - 10631215
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
10631164 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 10631215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 10887229 - 10887284
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| |||||||||||| |||||||||||||||||    
10887229 tttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 10887284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 18899842 - 18899889
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| |||||||||| |||||||||||||||||||||||||||||    
18899842 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 18899889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 22919981 - 22919926
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||| |||||||||    
22919981 tttaggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtc 22919926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24977778 - 24977829
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
24977778 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 24977829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 230
Target Start/End: Original strand, 33067344 - 33067395
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||||||| ||||||||||  |||||||||||||||||||||||||    
33067344 tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt 33067395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35056530 - 35056581
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35056530 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35056581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 35307714 - 35307765
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
35307714 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 35307765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35308111 - 35308060
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
35308111 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 35308060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 39303670 - 39303725
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||||| |||||||||| |||||| |||||||||||||||||||||||    
39303670 tttatgctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtc 39303725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 40718110 - 40718161
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
40718110 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 40718161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 45290824 - 45290769
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| | ||||||||| ||||||||||||||||||    
45290824 tttaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc 45290769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 180 - 231
Target Start/End: Complemental strand, 45638897 - 45638846
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||||| |||||| ||| |||||||||||||||||||||||||||    
45638897 ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 45638846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46868577 - 46868526
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||| || ||||||||||||||||||||||||||||||    
46868577 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 46868526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 50429213 - 50429158
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
50429213 tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 50429158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 3753214 - 3753264
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
3753214 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 3753264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 4789305 - 4789359
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| |||||||| |||||| ||| ||||||||||||||||||||||||||||||    
4789305 ttagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 4789359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 24654168 - 24654118
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||    
24654168 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag 24654118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 27521577 - 27521627
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
27521577 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 27521627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 32454297 - 32454243
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| |||||||||| |||||||    
32454297 ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtc 32454243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 44641079 - 44641129
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
44641079 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 44641129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 7819105 - 7819052
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
7819105 taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc 7819052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 21383102 - 21383155
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||| |||| |||||||||||||||||||||||||    
21383102 taggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc 21383155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||    
24649350 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag 24649399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 34808195 - 34808248
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||||||| || |||||||||||||||||||||||||||    
34808195 taggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtc 34808248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 42482977 - 42483030
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
42482977 taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 42483030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 47819230 - 47819283
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
47819230 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 47819283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
48955712 taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 48955765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 50799128 - 50799181
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
50799128 taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 50799181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 990087 - 990139
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| || |||||||| ||||||||||||||||||    
990087 aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc 990139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3679625 - 3679677
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| || |||||||| ||||||||||||||||||    
3679625 aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc 3679677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3753573 - 3753521
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||| ||||||| ||||||||||||||||||    
3753573 aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc 3753521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 7350426 - 7350474
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||||||| ||||||||||||||    
7350426 taaaatatggttttagtccctgcaaatatgtctcattttggttttagtc 7350474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10631529 - 10631477
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
10631529 aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc 10631477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||| ||| |||||||||||||||||||||||||||    
12322970 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 12322922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 12361010 - 12361062
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||| || ||||||||||||||||||    
12361010 aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtc 12361062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 15211510 - 15211562
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||| ||||||||||||||||||||||||||    
15211510 aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc 15211562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| | |||||||||||||||||| |||||||||    
16083046 aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc 16083098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 17984332 - 17984384
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||    
17984332 aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc 17984384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18900130 - 18900082
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
18900130 taaaatatggttttagtccctgcaaatatgactcgttttggttttagtc 18900082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19623018 - 19622966
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
19623018 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 19622966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24507844 - 24507792
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
24507844 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24507792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26442900 - 26442848
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
26442900 aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc 26442848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29688429 - 29688377
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
29688429 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 29688377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31258338 - 31258390
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||| ||||||| ||||||||||||||||||    
31258338 aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc 31258390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33045691 - 33045639
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
33045691 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 33045639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35005443 - 35005495
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
35005443 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 35005495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38150851 - 38150899
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
38150851 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 38150899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 38164296 - 38164244
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
38164296 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 38164244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 47819597 - 47819545
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
47819597 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 47819545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 52254182 - 52254234
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
52254182 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 52254234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3247566 - 3247511
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
3247566 tttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 3247511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12158690 - 12158741
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||||||||||||    
12158690 ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtc 12158741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 15516578 - 15516633
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| || |||||||||||||||    
15516578 tttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtc 15516633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
17984701 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 17984650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 24649664 - 24649609
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||||||||||  |||||||||| ||||||||||||||||||    
24649664 tttaggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 24649609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24653802 - 24653853
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
24653802 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24653853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26191359 - 26191410
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||||||||||||    
26191359 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 26191410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 29072862 - 29072811
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| |||| |||||||||||||    
29072862 ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtc 29072811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 30323297 - 30323242
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
30323297 tttaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 30323242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 31060787 - 31060838
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||||| |||||||||||||||    
31060787 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc 31060838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 37545628 - 37545679
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
37545628 ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc 37545679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 38151212 - 38151161
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
38151212 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 38151161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 44641432 - 44641381
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
44641432 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 44641381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 48956066 - 48956015
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| || |||||||||||||||    
48956066 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 48956015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 52254479 - 52254428
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
52254479 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 52254428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
4323829 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 4323879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 4360627 - 4360577
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||||| |||||||||| ||||||||||||||||||  ||||||||    
4360627 aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag 4360577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 15058419 - 15058469
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc 15058469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||| |||||| ||| |||||||||||||||||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 26142416 - 26142474
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||||||||||  |||||| || | ||||||||| |||||||||||||||||||||    
26142416 tttaggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcact 26142474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 32420099 - 32420149
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| |||  |||||||||||||||||||||||||||||    
32420099 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc 32420149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 44157696 - 44157746
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
44157696 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 44157746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||  ||||||||| ||||||||||| |||||||||||||||||    
7818783 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 7818832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 16026940 - 16026887
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
16026940 taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 16026887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22674201 - 22674254
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||  |||  |||||||||||||||||||||||||||||    
22674201 taggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc 22674254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 26207280 - 26207329
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| |||  |||||||||||||||||||||||||||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc 26207329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26324583 - 26324636
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
26324583 taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 26324636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 26324949 - 26324896
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | ||||||||  |||||||||| ||||||||||||||||||    
26324949 taggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc 26324896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35056896 - 35056843
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
35056896 taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 35056843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 45368847 - 45368798
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| | |||||||| ||||||||||| ||||||||||||||||||    
45368847 ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtc 45368798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 49073690 - 49073739
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||| |||  ||||||||||||||||||||||||||    
49073690 aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 49073739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 50428872 - 50428921
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| ||||||||||  |||||||||||||||||||| |||||    
50428872 aggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta 50428921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 7350733 - 7350685
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||||||||||||||  ||||||||||||||||||    
7350733 taaaatatggttttggtcactgcaaatatacctcgttttggttttagtc 7350685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 7867358 - 7867306
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||  ||||||||||||||    
7867358 aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtc 7867306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8140800 - 8140748
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||  ||||||||||| ||||||||||||||||||    
8140800 aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtc 8140748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||| ||| | |||||||||||||||||||||||||    
25658014 ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta 25658062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31061152 - 31061100
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || |||||||||| |||||||||||||||||||    
31061152 aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtc 31061100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31258699 - 31258651
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| |||||||| |||||||||    
31258699 taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtc 31258651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33234545 - 33234597
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
33234545 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 33234597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 36912851 - 36912895
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttg 225  Q
    |||||||||||| |||||| ||| |||||||||||||||||||||    
36912851 taggctaaaatatggttttggtccctgcaaatatgtctcgttttg 36912895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 37624745 - 37624793
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||| |||| ||||| ||||||||||| ||||||||||||||    
37624745 aggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt 37624793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38163934 - 38163982
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
38163934 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 38163982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39747473 - 39747524
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||| ||||||||||||||||||||    
39747473 aggctaaaatatggttttggtc-ctgcaaatacgtctcgttttggttttagtc 39747524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44158043 - 44157991
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| || |||||||||||||||    
44158043 aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtc 44157991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 3679986 - 3679935
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||| ||||||||    
3679986 ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc 3679935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 237
Target Start/End: Original strand, 8364619 - 8364670
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||| ||||||  || |||||||||||| ||||||||||||||||||||    
8364619 taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcact 8364670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 8364920 - 8364869
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||||||  ||||| ||| | ||||||||||||||||||||||||    
8364920 tttaggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt 8364869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||  |||||  || |||||||||||||||||||||||||||||    
15058767 aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt 15058716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 15335292 - 15335245
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| | |||||||| ||||||||||| |||||||||||||||||    
15335292 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 15335245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 16060595 - 16060649
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||||||| |||||| ||| || |||||||| |||||||||||||||||||||    
16060595 aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcact 16060649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16060885 - 16060834
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
16060885 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 16060834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 225
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttg 225  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||    
18079661 aggctaaaatatggttttagtccctgcaaatatgcctcgttttg 18079618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 20948755 - 20948806
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| || |||||||||||||||| ||||||||||    
20948755 ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtc 20948806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 24507479 - 24507530
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
24507479 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 24507530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 26062255 - 26062208
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| |||||||||| ||| ||||||||||| |||||||||||||    
26062255 taaaatatggttttagtccctgtaaatatgtctcattttggttttagt 26062208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 33000305 - 33000356
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
33000305 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc 33000356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 33045351 - 33045406
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||  |||||| ||| ||||||||||| || |||||||||||||||    
33045351 tttaggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtc 33045406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||  |||||||||  ||||||||||||||||||||||||||    
33067729 gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta 33067682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 37625031 - 37624976
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||||| |||||||||| ||| |||||||| ||||||||||| |||||    
37625031 tttaagctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc 37624976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 38136981 - 38136930
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
38136981 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 38136930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 41739122 - 41739072
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||   |||||||||||||||||    
41739122 taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtc 41739072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 45380636 - 45380585
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
45380636 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 45380585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45638580 - 45638631
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
45638580 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 45638631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 2939934 - 2939980
Alignment:
188 aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| ||||||| || ||||||||||| ||||||||||||||||||    
2939934 aaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 2939980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 15334915 - 15334965
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| ||||||| || ||| ||||||| |||||||||||||||    
15334915 taggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta 15334965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 200 - 234
Target Start/End: Original strand, 18302070 - 18302104
Alignment:
200 agtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||||||||||||||||||||||||||    
18302070 agtccctgcaaatatgtctcgttttggttttagtc 18302104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 18928141 - 18928091
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||||||| |||| |||||||||    
18928141 gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtc 18928091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 292860 - 292910
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  |||||||||| ||||||||||| ||||||||| ||||||||    
292860 aggctaaaat--ggttttagtccctgcaaatatgcctcgttttgcttttagtc 292910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||| |||||||||| |||||||||||||| ||||||||||||    
4360299 taaaatatggttttagtc-ctgcaaatatgtcttgttttggtttta 4360343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 4565338 - 4565285
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||| | ||| ||||||||||||||||||||  ||||||||    
4565338 taggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtc 4565285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 28507460 - 28507407
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||  ||||| ||| ||||||||||||||| |||| |||||||||    
28507460 taggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtc 28507407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 32035458 - 32035487
Alignment:
205 ctgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||||||||||||||||||    
32035458 ctgcaaatatgtctcgttttggttttagtc 32035487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 46183686 - 46183735
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| |||||||||||  |||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 46183735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18079397 - 18079449
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| |||  |||||||||| ||| ||||||||||||||    
18079397 aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtc 18079449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 19721071 - 19721023
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
19721071 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 19721023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 34002634 - 34002682
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||| || | |||| ||| ||||||||||||||||||||||||||    
34002634 aggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt 34002682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 39025112 - 39025156
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||| |||||| ||| ||||||||||||||||||||| ||||    
39025112 taaaatatggttttggtccctgcaaatatgtctcgttttgatttt 39025156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 4037 - 4092
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
4037 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 4092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 19219 - 19274
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
19219 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 19274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4289 - 4237
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
4289 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 4237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19471 - 19419
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
19471 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 19419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 48; Significance: 3e-18; HSPs: 163)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 39832902 - 39832957
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
39832902 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 39832957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44344790 - 44344738
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
44344790 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 44344738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 233
Target Start/End: Complemental strand, 48359081 - 48359025
Alignment:
177 agtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||    
48359081 agttttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 48359025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 13769774 - 13769825
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
13769774 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 13769825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 19561450 - 19561399
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
19561450 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 19561399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 25988381 - 25988436
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
25988381 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 25988436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35210515 - 35210464
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
35210515 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 35210464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35838341 - 35838286
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35838341 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35838286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 46759654 - 46759709
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
46759654 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 46759709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 23816667 - 23816721
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
23816667 ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 23816721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 30709647 - 30709593
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| | |||||||| ||||||||||||||||||||||||||||||    
30709647 ttaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 30709593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 1614557 - 1614610
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
1614557 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 1614610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 17999723 - 17999670
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
17999723 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 17999670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19783813 - 19783866
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||  ||||||||| ||||||||||||||||||||||||||||||    
19783813 taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc 19783866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6108333 - 6108385
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
6108333 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 6108385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8144294 - 8144346
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
8144294 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8144346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12894403 - 12894351
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
12894403 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 12894351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19757747 - 19757799
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
19757747 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 19757799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 23399977 - 23399925
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
23399977 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 23399925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25092159 - 25092211
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
25092159 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 25092211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 27458398 - 27458450
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
27458398 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 27458450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28911907 - 28911855
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
28911907 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 28911855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35837923 - 35837975
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35837923 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35837975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44509055 - 44509003
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
44509055 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 44509003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1006835 - 1006886
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
1006835 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 1006886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1974009 - 1974060
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||| |||||||||||||||||    
1974009 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc 1974060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3975842 - 3975787
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
3975842 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 3975787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
7431951 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 7432002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 17854145 - 17854200
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| |||||||| |||||||||| ||||||||||||||| ||||||||||||||    
17854145 tttagactaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc 17854200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 20388270 - 20388325
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| || |||||||||||||||    
20388270 tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 20388325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 23399608 - 23399663
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
23399608 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 23399663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 23676128 - 23676183
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
23676128 tttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 23676183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25547490 - 25547439
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
25547490 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 25547439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 37372441 - 37372488
Alignment:
187 aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||||||||| ||||||||||||||||||||||||||||||    
37372441 aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 37372488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 37372905 - 37372854
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
37372905 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 37372854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 44403249 - 44403198
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||||||  |||||||||||||||||||||||||||||    
44403249 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 44403198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 44508720 - 44508771
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
44508720 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 44508771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||||    
19561154 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 19561204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 31310362 - 31310416
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| | |||||||| |||||||||| |||||||||||||||||||    
31310362 ttaggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc 31310416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 32189393 - 32189339
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| |||||||| |||||||||| ||||||||||| ||||||||||||||||||    
32189393 ttagactaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtc 32189339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 39719645 - 39719591
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| |||||||| |||||||||    
39719645 ttaggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtc 39719591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 43300613 - 43300663
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||  ||||||||||||||||||||||||||||||    
43300613 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtc 43300663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 8144660 - 8144607
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
8144660 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 8144607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 8555800 - 8555751
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||    
8555800 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 8555751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||| |||||||||| | |||||||||||||||||||||||||||    
18022368 gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt 18022417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 18022706 - 18022653
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
18022706 taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 18022653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 23676454 - 23676401
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
23676454 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 23676401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 26878073 - 26878020
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
26878073 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 26878020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28911575 - 28911628
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| |||||||| |||||||||    
28911575 taggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtc 28911628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 29198301 - 29198354
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| |||||||||| |||||||||||||||||||    
29198301 taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtc 29198354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29198664 - 29198611
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
29198664 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 29198611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35015222 - 35015169
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
35015222 taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 35015169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 45671550 - 45671497
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| ||||||||||| ||||||||||||||||||| |||||||||    
45671550 taggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtc 45671497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||    
46648716 aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta 46648667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 48192490 - 48192437
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
48192490 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 48192437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 489073 - 489021
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||||||||||||| ||||||||    
489073 aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtc 489021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1614905 - 1614853
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
1614905 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 1614853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3975548 - 3975600
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
3975548 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 3975600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5234205 - 5234153
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| || |||||||||||||||||||||||||||    
5234205 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc 5234153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6509207 - 6509259
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| |||||||| |||||||||    
6509207 aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtc 6509259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6509471 - 6509419
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| || |||||||| ||||||||||||||||||    
6509471 aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc 6509419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9659690 - 9659638
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
9659690 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 9659638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14543709 - 14543761
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
14543709 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 14543761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 21223749 - 21223697
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||  ||||||||||||||||||    
21223749 aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc 21223697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25988750 - 25988698
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
25988750 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 25988698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26877677 - 26877729
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
26877677 aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtc 26877729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30223460 - 30223512
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| | ||||||||||||||||||||||||||||    
30223460 aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtc 30223512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||||||||||||| ||||||||    
31503780 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 31503732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 39439030 - 39438978
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||| ||||||||||||||||||||    
39439030 aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc 39438978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44568691 - 44568639
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
44568691 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 44568639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 45021858 - 45021806
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| ||||||||||| ||| |||||||||||||    
45021858 taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 45021806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 45073310 - 45073362
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||||| |||||||||| ||||||||| | |||||||||||||||    
45073310 tttaggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta 45073362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45073642 - 45073590
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| ||||||||||| ||||||||||||||||||    
45073642 aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 45073590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45228919 - 45228867
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
45228919 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 45228867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46828943 - 46828995
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||||| |||||||||||||||    
46828943 aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc 46828995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5308323 - 5308374
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||||||  ||||||||||||||||||| |||||||||    
5308323 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc 5308374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 5354764 - 5354819
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||| ||||||| ||||||||||||||||||    
5354764 tttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 5354819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 10358368 - 10358317
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
10358368 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 10358317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 13770082 - 13770031
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| | |||||||||||||||    
13770082 aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagt 13770031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16853589 - 16853538
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
16853589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 16853538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 17999465 - 17999512
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||    
17999465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt 17999512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 23817035 - 23816984
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||| ||||||||||||||||||| |||||    
23817035 aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagt 23816984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35104299 - 35104244
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||| |||||| ||| ||||||||||| ||||||||||||||||||    
35104299 tttaggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 35104244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 39833236 - 39833185
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||  ||||||||||| ||||||||||||||||||    
39833236 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc 39833185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 41054240 - 41054185
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
41054240 tttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 41054185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 41364884 - 41364935
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||| || || |||||||||||||||||||||||||||    
41364884 ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtc 41364935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46304384 - 46304333
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  ||||||||| |||||||||||| |||||||||||||||||    
46304384 ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtc 46304333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46759942 - 46759891
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||||||||||||||||||||||||||||||    
46759942 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 46759891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 6079810 - 6079860
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
6079810 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 6079860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 35665874 - 35665928
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| ||||||| || || |||||||| ||||||||||||||||||    
35665874 ttaggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtc 35665928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 39438738 - 39438792
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||| ||||||| ||||||||||||||||||    
39438738 ttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 39438792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9659353 - 9659406
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||||||||||||| ||||||||    
9659353 taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc 9659406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 10357999 - 10358052
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | | |||||| ||||||||||| ||||||||||||||||||    
10357999 taggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtc 10358052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 19465982 - 19465930
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||| | ||||||||||||||||||| ||||||||||    
19465982 taggctaaaatatggttttagcc-ctgcaaatatgtctcgtttcggttttagtc 19465930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 21554755 - 21554702
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| || |||||| ||||||||    
21554755 taggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtc 21554702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| ||||||  || |||||||||||||||||||||||||||    
34878126 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 34878077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1559706 - 1559654
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||  ||||||||    
1559706 aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtc 1559654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 3807862 - 3807914
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||||  ||||| ||  |||||||||||||||||||||||||||||    
3807862 taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagt 3807914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5233807 - 5233859
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
5233807 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 5233859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14739005 - 14738953
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||| ||||||||    
14739005 aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtc 14738953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||||||||||||  ||||||||    
18891562 taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc 18891514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 18927091 - 18927039
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    ||||||||||  ||||||||| ||||||||||||||| |||| ||||||||||    
18927091 ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtca 18927039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25092549 - 25092497
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
25092549 aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtc 25092497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 25547251 - 25547303
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||| ||||||| ||||||| || ||||||||||| |||||||||||||||||    
25547251 taggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 25547303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||    
28529206 taaaatatggttttggtctctgcaaatatgtctcgttttggtttt 28529162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30223796 - 30223744
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| |||  |||||||||| ||||||||||||||||||    
30223796 aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtc 30223744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30352563 - 30352611
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||| ||||    
30352563 taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtc 30352611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| ||||||||| |||||    
31732101 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta 31732149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 34877777 - 34877825
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||| ||||||||||||||||||||||||||    
34877777 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc 34877825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35104077 - 35104129
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||   |||| ||| ||||||||||||||||||||||||||||||    
35104077 aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtc 35104129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||| |||||||||| |||||||||||||||    
37953048 taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc 37953000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39520397 - 39520449
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| |||  | |||||||||||||||||||||||||||    
39520397 aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtc 39520449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44402959 - 44403011
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| | | ||||||||||||||    
44402959 aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtc 44403011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44568325 - 44568377
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||  ||||||||||||||||||    
44568325 aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtc 44568377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44958507 - 44958455
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| || |||||||||||||||||||||||||||    
44958507 aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtc 44958455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45021494 - 45021546
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgtttt-ggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| |||||||| ||||||||||    
45021494 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtc 45021546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 45671212 - 45671264
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||| ||||||| ||||||||||  ||||||||||||||||||| ||||||||    
45671212 taggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagt 45671264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46304085 - 46304137
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||  ||||||||||| ||||||||||||||||||    
46304085 aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtc 46304137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 48192260 - 48192308
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
48192260 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 48192308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 48852443 - 48852495
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
48852443 aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc 48852495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||    
6589021 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 6589068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
187 aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||||| ||| |||||||||| |||||||||||||||||||    
6954862 aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc 6954909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 11767279 - 11767224
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| |||||||||||  || ||||||||||||||    
11767279 tttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtc 11767224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||| |||||||||| || |||||||| |||||||||||||||    
18311581 gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta 18311628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| |||||||||||  |||||||||||||||||    
21223405 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc 21223456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 21554393 - 21554444
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||| ||||||| ||||||||||||||||||    
21554393 ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtc 21554444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 24717532 - 24717481
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| || | |||||||||||||||||||||||||    
24717532 ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtc 24717481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 27037593 - 27037644
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
27037593 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc 27037644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30352904 - 30352853
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  ||||||||| ||||||||||| ||||||||| ||||||||    
30352904 ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtc 30352853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||||||| |||||||||||  ||||||||||||    
31310680 aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt 31310633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35469880 - 35469931
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||  || |||||||||||| |||||||||||||||||    
35469880 ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc 35469931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| || |||||||| ||| ||||||||||||||    
39719353 ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc 39719404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 46829312 - 46829261
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||  || ||||||||||||||| ||||||||||||||    
46829312 ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtc 46829261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||| ||||||||||||||||||||||||||||||    
3808106 ttttggtccctgcaaatatgtctcgttttggttttagtc 3808068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 5355119 - 5355065
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    |||| |||| || |||||| ||| ||||||||||| |||||||||||||||||||    
5355119 taggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtca 5355065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 28262711 - 28262761
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||||| ||| ||||||||||| ||| |||||||||||    
28262711 taggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta 28262761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||| ||||||    
31732452 aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag 31732402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 37527421 - 37527371
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| || ||||||||||| |||||||||||||||    
37527421 gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtc 37527371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 38186747 - 38186709
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||| ||||||||||||||||||||||||||||||    
38186747 ttttggtccctgcaaatatgtctcgttttggttttagtc 38186709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 38486474 - 38486528
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| | |||| ||| ||| |||||||||||||||| ||||||||    
38486474 tttaggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt 38486528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 1559342 - 1559391
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||  ||||||||| ||||||||||| ||||||||| |||||    
1559342 aggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta 1559391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| |||||||||||  |||||||||||||||||    
6847117 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 6847068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 6892262 - 6892209
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||| |||||| ||||||| |||||||    
6892262 taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtc 6892209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 12932785 - 12932732
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||| ||| ||||||||||| ||||||||| ||||||||    
12932785 taggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtc 12932732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 37952671 - 37952720
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||| ||||||||||  ||||||||||||||    
37952671 ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtc 37952720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 233
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||| |||||||||  | ||||||||| |||||||||||||||||    
41365213 gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt 41365164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43058752 - 43058801
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||  ||||||||| |||||||||||||| |||||| ||||||||    
43058752 ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtc 43058801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 44344456 - 44344505
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||  | ||||||||||||||||| |||||||    
44344456 aggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta 44344505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 189 - 229
Target Start/End: Original strand, 488720 - 488760
Alignment:
189 aatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    |||| ||||||||||  ||||||||||||||||||||||||    
488720 aatatggttttagtccttgcaaatatgtctcgttttggttt 488760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 234
Target Start/End: Complemental strand, 1271588 - 1271548
Alignment:
194 ggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||| ||||||||||| ||||||||||||||||||    
1271588 ggttttggtccctgcaaatatgcctcgttttggttttagtc 1271548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2945846 - 2945794
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| || |||||||| ||||||||||||||||||    
2945846 aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtc 2945794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5308687 - 5308636
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||  ||||||||||||||||||    
5308687 aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtc 5308636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 6589271 - 6589223
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| || |||||||||||||||    
6589271 taaaatatggttttggtccctgcaaatatgccttgttttggttttagtc 6589223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 8555603 - 8555655
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||||||  ||||||||  ||||||||||| || ||||||||||||    
8555603 tttaggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta 8555655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||    
11766920 taaaatatggttttggtccctgcaaatatgcctcgttttggtttt 11766964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16940761 - 16940813
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||| |||||| ||| ||||||||||| |||| |||||||||||||    
16940761 aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtc 16940813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 16941049 - 16941001
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
16941049 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 16941001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 30709328 - 30709376
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| | |||||||| || |||||||| ||||||||||||||||||    
30709328 taaaatatgattttagtccctacaaatatgcctcgttttggttttagtc 30709376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| | |||||||| |||||||||||  ||||||||||||||    
32189076 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta 32189124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 38486794 - 38486738
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    |||||||||||||| ||||||  || ||| ||||||| | |||||||||||||||||    
38486794 tttaggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtca 38486738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 39520727 - 39520679
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| |||  |||||||||||||||||||| ||||||||    
39520727 taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtc 39520679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41053841 - 41053893
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||| ||||||||    
41053841 aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtc 41053893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 48854071 - 48854019
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | ||||  || |||||||||||| |||||||||||||||||    
48854071 aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtc 48854019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 180)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 24474964 - 24474905
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta 241  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||    
24474964 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctagta 24474905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 46088064 - 46088009
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
46088064 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 46088009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 45593590 - 45593536
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||||||| |||||||||||||||||||||||||||||    
45593590 tttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagt 45593536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9289264 - 9289317
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
9289264 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 9289317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 13479613 - 13479560
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
13479613 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 13479560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 13631223 - 13631279
Alignment:
178 gtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
13631223 gtttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 13631279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22099913 - 22099861
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
22099913 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 22099861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29380911 - 29380859
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
29380911 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 29380859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 34361802 - 34361854
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
34361802 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 34361854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 32208541 - 32208600
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta 241  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||| ||||||    
32208541 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagta 32208600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 35464014 - 35464069
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35464014 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35464069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 50714565 - 50714514
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
50714565 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 50714514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 32365090 - 32365144
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
32365090 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 32365144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 35763644 - 35763698
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
35763644 ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 35763698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 51708690 - 51708744
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
51708690 ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 51708744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 52430103 - 52430049
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| |||||||||||||||||||| |||||||||    
52430103 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc 52430049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 5882542 - 5882602
Alignment:
173 gaaaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
5882542 gaaaaatttaggctaaaatatggttttagtc-ctgcaaatatgcctcgttttggttttagtc 5882602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9289641 - 9289588
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||| |||||||||| ||||||||||||||||||||||||||||||    
9289641 taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 9289588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 22584285 - 22584338
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  |||||||||||||||||||||||||||||    
22584285 taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 22584338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29420539 - 29420486
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
29420539 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 29420486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35119613 - 35119560
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||||||||||||||||||||||||||||| ||||    
35119613 taggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtc 35119560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 41346220 - 41346167
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||| ||||||||||||||    
41346220 taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc 41346167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 52441761 - 52441814
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
52441761 taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 52441814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 53716919 - 53716972
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| |||||||||||||| |||||||||||||||    
53716919 taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc 53716972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13064466 - 13064414
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
13064466 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 13064414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14791807 - 14791755
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
14791807 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 14791755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16712692 - 16712640
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
16712692 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 16712640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18205155 - 18205207
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
18205155 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 18205207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 18205521 - 18205473
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| |||||||||| |||||||||||||||||||||||||||||    
18205521 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 18205473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25423923 - 25423975
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
25423923 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 25423975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25424313 - 25424261
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
25424313 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 25424261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32365484 - 32365432
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
32365484 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 32365432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 36701999 - 36702051
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
36701999 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 36702051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41345852 - 41345904
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
41345852 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 41345904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 43231087 - 43231139
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
43231087 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 43231139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46115780 - 46115728
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||| ||||||||||||||||||||    
46115780 aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtc 46115728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46128914 - 46128862
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||| ||||||||||||||||||||    
46128914 aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtc 46128862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 52017504 - 52017556
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
52017504 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 52017556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52017871 - 52017819
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
52017871 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 52017819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52442093 - 52442041
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||||||||||||||||||||||    
52442093 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 52442041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 53916049 - 53915997
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| |||||||||||||||||||||||||||||    
53916049 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 53915997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 4279018 - 4279073
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||| | |||||||||| |||||||||||||||||||    
4279018 tttaggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtc 4279073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 13064155 - 13064210
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
13064155 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 13064210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 13073759 - 13073810
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
13073759 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 13073810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||    
13479273 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 13479320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 14488191 - 14488136
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
14488191 tttaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 14488136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 235
Target Start/End: Complemental strand, 15555637 - 15555586
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    |||||||||  ||||||||| |||||||||||||||||||||||||||||||    
15555637 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtca 15555586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 22099543 - 22099594
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
22099543 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 22099594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
23778963 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 23779014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35415633 - 35415582
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
35415633 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 35415582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 233
Target Start/End: Original strand, 42823767 - 42823826
Alignment:
174 aaaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||| |||||||||||||| | |||| ||| |||||||||||||||||||||||||||||    
42823767 aaaattttaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 42823826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 45505895 - 45505844
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
45505895 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 45505844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 53717174 - 53717123
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
53717174 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 53717123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 123532 - 123585
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
123532 taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 123585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 11693123 - 11693070
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||| ||||||||    
11693123 taggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtc 11693070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 12152495 - 12152446
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||    
12152495 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt 12152446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 19903653 - 19903604
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| ||||||||||||||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 19903604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 23245597 - 23245544
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
23245597 taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 23245544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26412188 - 26412241
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
26412188 taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 26412241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 176 - 241
Target Start/End: Complemental strand, 32208908 - 32208843
Alignment:
176 aagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta 241  Q
    ||||| ||||||||||| ||||||| || ||||||||||| ||||||||| |||||||| ||||||    
32208908 aagttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccctagta 32208843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 41619897 - 41619950
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
41619897 taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 41619950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 43368467 - 43368516
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| |||||||||||| |||||||||||||||||    
43368467 ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc 43368516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 51545971 - 51545918
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
51545971 taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 51545918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2034856 - 2034804
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| | ||||||||| ||||||||||||||||||    
2034856 aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtc 2034804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2180219 - 2180271
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
2180219 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 2180271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5052585 - 5052533
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||| |||||||||| ||||||||||| ||||||||||||||||||    
5052585 aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 5052533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5827974 - 5827922
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
5827974 aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc 5827922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
6827545 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 6827597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 6827875 - 6827823
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
6827875 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 6827823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8760603 - 8760655
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  |||||| || ||||||||||||||||||||||||||||||    
8760603 aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtc 8760655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8760782 - 8760730
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
8760782 aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtc 8760730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13530714 - 13530662
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
13530714 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 13530662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13631600 - 13631548
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
13631600 aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc 13631548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 15555506 - 15555554
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
15555506 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 15555554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 23779226 - 23779174
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||| ||||||||||||||    
23779226 aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtc 23779174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24774044 - 24774096
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
24774044 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24774096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28809181 - 28809129
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
28809181 aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc 28809129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 29380667 - 29380715
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||||  ||||||||| ||||||||||||||||||||||||||    
29380667 aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt 29380715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 230
Target Start/End: Complemental strand, 29463914 - 29463866
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||    
29463914 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt 29463866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29499181 - 29499233
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
29499181 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 29499233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30046793 - 30046741
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
30046793 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 30046741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30061134 - 30061082
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
30061134 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 30061082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31812214 - 31812162
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||  ||||||||||||||||||||||||||||||    
31812214 aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc 31812162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 38054549 - 38054597
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
38054549 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 38054597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 41921085 - 41921033
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||| | |||||||||||| |||||||||||||||||    
41921085 aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtc 41921033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 42848026 - 42848078
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||  ||||||||||||||||||||||||||||||    
42848026 aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc 42848078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43231390 - 43231338
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
43231390 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 43231338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
44925484 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 44925536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 45505599 - 45505651
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||||||||||    
45505599 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 45505651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46292652 - 46292600
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
46292652 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 46292600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51545628 - 51545680
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||  ||||||||||||||||||    
51545628 aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc 51545680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 51709028 - 51708976
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
51709028 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 51708976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
54208822 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 54208774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 55072388 - 55072440
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
55072388 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 55072440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 2322433 - 2322382
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| ||||||  || |||||||||||||||||||||||||||||    
2322433 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 2322382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4279335 - 4279284
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
4279335 ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtc 4279284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5827655 - 5827706
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
5827655 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 5827706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 12791978 - 12791923
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
12791978 tttaggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtc 12791923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 13074129 - 13074074
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||  ||||||||||||||||||    
13074129 tttaggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc 13074074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 13764613 - 13764664
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||| ||||    
13764613 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtc 13764664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14594202 - 14594257
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| |||||||||||||||  |||||||||||||    
14594202 tttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtc 14594257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 19321859 - 19321808
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||| |||||||||||||||||    
19321859 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 19321808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 22584611 - 22584556
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||  |||||||||| |||||||||||  |||||||||||||||||    
22584611 tttaggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtc 22584556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 23245231 - 23245282
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
23245231 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 23245282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26412584 - 26412533
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
26412584 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc 26412533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 27008084 - 27008135
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  ||||||||| ||||||||||| ||||||||||||||||||    
27008084 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 27008135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 28809011 - 28809062
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||||||  ||||||||||| |||||||||||||||||    
28809011 ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtc 28809062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31560695 - 31560644
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
31560695 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 31560644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35464382 - 35464331
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
35464382 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 35464331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42848391 - 42848340
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
42848391 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 42848340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 46115414 - 46115465
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
46115414 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 46115465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 46128548 - 46128599
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
46128548 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 46128599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 50714240 - 50714291
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
50714240 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 50714291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 53308068 - 53308017
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||| ||||||||||||||||    
53308068 ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtc 53308017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 11285504 - 11285554
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
11285504 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 11285554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 27008401 - 27008355
Alignment:
188 aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| |||||||||| ||||||||||| ||||||||||||||||||    
27008401 aaatatggttttagtctctgcaaatatgcctcgttttggttttagtc 27008355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 36050289 - 36050339
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| | ||||||||||||||||||||||||||||    
36050289 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtc 36050339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 47023108 - 47023054
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| ||||||  || |||||||||||| |||||||||||||||||    
47023108 ttaggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc 47023054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 47136170 - 47136120
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 47136120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||  ||||||||  |||||||||||||||||||||||||||||    
47274230 ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 51738135 - 51738185
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||||| ||| || ||||||||||||||||||||||||    
51738135 taggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta 51738185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 55072714 - 55072664
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||| ||||||| |||||||||| ||||||||||| |||||||||||||||    
55072714 taggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 55072664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 4211559 - 4211608
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||    
4211559 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 4211608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 9445951 - 9446000
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| | |||||||| ||||||||||| ||||||||||||||||||    
9445951 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 9446000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13530377 - 13530430
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||||||||||||| ||||||||    
13530377 taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc 13530430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 14487800 - 14487849
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||    
14487800 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 14487849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18831176 - 18831127
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||| |||||||||| |||||||||||||||    
18831176 ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc 18831127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 20291984 - 20292037
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
20291984 taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 20292037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28448832 - 28448885
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  | |||||||| ||||||||||||||||||    
28448832 taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc 28448885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30564835 - 30564884
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| |||||||||||| | |||||||||||||||    
30564835 ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtc 30564884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 34355285 - 34355232
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||  ||||||| ||||||||||||||||||    
34355285 taggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtc 34355232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 35415297 - 35415350
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||| |||||||  |||||||||||||||||    
35415297 taggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc 35415350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35763957 - 35763904
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||| ||||| ||||| ||||||||||||||||||    
35763957 taggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtc 35763904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||| |||  ||||||||||||||||||||||||||    
52543421 aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 53915681 - 53915734
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
53915681 taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc 53915734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 5797484 - 5797532
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| | |||| ||| ||||||||||||||||||||||||||||||    
5797484 taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtc 5797532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13764808 - 13764756
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||| |||||||| |||||||||||||||||    
13764808 aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtc 13764756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24474599 - 24474650
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
24474599 aggctaaaatatggttttagtc-ctgcaaatatgcatcgttttggttttagtc 24474650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26314333 - 26314281
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||| ||||||||||||||||||||||||||    
26314333 aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtc 26314281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 27427871 - 27427922
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||    
27427871 aggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtc 27427922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 29499543 - 29499495
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
29499543 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 29499495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31182505 - 31182453
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| |  ||||||||||||||||||||||||| ||||    
31182505 aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtc 31182453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 31370802 - 31370854
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||  |||| |||||| |||||||||||||||||    
31370802 taggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt 31370854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31811924 - 31811976
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || |||||||||||| |||||||||||||||||    
31811924 aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtc 31811976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 36054151 - 36054099
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
36054151 aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtc 36054099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 41620257 - 41620205
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||| |||||||  |||||||||||||||||    
41620257 aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc 41620205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45474597 - 45474545
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  ||| |||||||||||||    
45474597 aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc 45474545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 47022743 - 47022791
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| |||  |||||||||||||||||||||||||||||    
47022743 taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc 47022791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 54903476 - 54903424
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| | ||||||||||||||||    
54903476 aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtc 54903424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2180572 - 2180521
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  ||||||||| ||||||||||| | ||||||||||||||||    
2180572 ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtc 2180521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8191391 - 8191340
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||| ||||| ||||    
8191391 ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtc 8191340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Complemental strand, 9446323 - 9446276
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||| | |||||||| ||| ||||||||||||||||||||||    
9446323 ggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt 9446276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25358540 - 25358489
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||| ||||||||||||||||||||||||||    
25358540 ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtc 25358489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 41324890 - 41324839
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
41324890 ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtc 41324839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42824091 - 42824040
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||||| |||||| ||||||||    
42824091 ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtc 42824040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 46292392 - 46292439
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||    
46292392 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 46292439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 55482468 - 55482417
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| || |||||||| ||||||||||||||||||    
55482468 ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtc 55482417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 123893 - 123847
Alignment:
188 aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| |||||||||| ||||||||||| ||| ||||||||||||||    
123893 aaatatggttttagtccctgcaaatatgcctcattttggttttagtc 123847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 5797822 - 5797772
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||| ||||||| |||||| ||| || ||||||||||||||||||||||||    
5797822 taggttaaaatatggttttggtccctacaaatatgtctcgttttggtttta 5797772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6353637 - 6353587
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||  ||||||||||||||||||    
6353637 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc 6353587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 194 - 228
Target Start/End: Complemental strand, 25358498 - 25358464
Alignment:
194 ggttttagtcactgcaaatatgtctcgttttggtt 228  Q
    |||||||||| ||||||||||||||||||||||||    
25358498 ggttttagtccctgcaaatatgtctcgttttggtt 25358464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 36702362 - 36702312
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||  ||||| ||||| ||||||||||||||||||    
36702362 gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtc 36702312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 44925844 - 44925794
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| | ||||||||| ||||||||||||||||||    
44925844 gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtc 44925794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 45593225 - 45593279
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||  ||||||||| || |||||||| |||||||||| |||||||    
45593225 ttaggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtc 45593279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 2322094 - 2322143
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||| |||||| ||| || |||||||| |||||||||||||||||    
2322094 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt 2322143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||  ||||| ||| ||||||||||| |||||||||||||||    
8904885 aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12152152 - 12152205
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| |||||||  |||||||||    
12152152 taggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtc 12152205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||||| || ||||||||||| ||||||||||| ||||||    
16712331 ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc 16712380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||| |||  |||||||||||||||||||| |||||    
28449215 aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 30060767 - 30060820
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
30060767 taggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtc 30060820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 35420701 - 35420652
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| |||  ||||||||||||||| |||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtc 35420652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 41439785 - 41439838
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||||| | ||| |||||| |||||||||||||||||||    
41439785 taggttaaaatatggttttagcctctgtaaatatttctcgttttggttttagtc 41439838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 47532667 - 47532622
Alignment:
188 aaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||| |||||| |||  ||||||||||||||||||||||||||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagt 47532622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 51830891 - 51830940
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||  ||||||||| ||||| |||||||| |||||||||||||||    
51830891 ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtc 51830940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 5202929 - 5202985
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcg-ttttggttttagtcactagta 241  Q
    ||||||| |||||| ||| ||||||||||| |||| |||||||||||||| ||||||    
5202929 taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccctagta 5202985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
14791502 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 14791550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28197278 - 28197230
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| || |||||||||||||| || |||||||||    
28197278 taaaatatggttttagtctctacaaatatgtctcgtctttgttttagtc 28197230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| ||||||| |  ||||||||||| |||||||||||||||    
29463610 ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta 29463658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31560330 - 31560382
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || |||||||||||  |||||||||||||||||    
31560330 aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtc 31560382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35119291 - 35119343
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||   ||||||||||||||||    
35119291 aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtc 35119343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 162)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 40786456 - 40786511
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
40786456 tttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtc 40786511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 38639409 - 38639463
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
38639409 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 38639463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 10671943 - 10671890
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
10671943 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 10671890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 11788418 - 11788365
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
11788418 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 11788365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19183781 - 19183833
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
19183781 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 19183833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5790899 - 5790848
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
5790899 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 5790848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 11713485 - 11713536
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
11713485 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 11713536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 20131313 - 20131368
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
20131313 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 20131368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 238
Target Start/End: Original strand, 23989834 - 23989893
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcacta 238  Q
    |||||||||||||| | |||||||| ||||||||||| ||||||||||||||||||||||    
23989834 tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcacta 23989893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26813866 - 26813917
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
26813866 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 26813917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 36622250 - 36622301
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
36622250 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 36622301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 44985988 - 44985933
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
44985988 tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 44985933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 9195054 - 9195104
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||||    
9195054 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 9195104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13215058 - 13215111
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
13215058 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 13215111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 26239162 - 26239109
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
26239162 taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 26239109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 40302341 - 40302288
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
40302341 taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 40302288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 41451835 - 41451888
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
41451835 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 41451888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 43788856 - 43788909
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
43788856 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 43788909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 44559060 - 44559113
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
44559060 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 44559113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4424186 - 4424134
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
4424186 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 4424134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||    
10375069 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10375021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 11713846 - 11713794
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
11713846 aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc 11713794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16900207 - 16900155
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
16900207 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 16900155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16993598 - 16993546
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
16993598 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 16993546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 17541777 - 17541725
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
17541777 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 17541725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19184152 - 19184100
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
19184152 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 19184100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22881612 - 22881664
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
22881612 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 22881664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24483892 - 24483840
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
24483892 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 24483840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25705084 - 25705136
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
25705084 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 25705136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 26814230 - 26814178
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
26814230 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 26814178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31644840 - 31644892
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
31644840 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 31644892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33576118 - 33576066
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
33576118 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 33576066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 33732861 - 33732913
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
33732861 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 33732913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37271738 - 37271790
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
37271738 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 37271790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37272103 - 37272051
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
37272103 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 37272051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 38980254 - 38980202
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
38980254 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 38980202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41693673 - 41693725
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||| |||||||||||||||||    
41693673 aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc 41693725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 17912445 - 17912500
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| | |||||||| ||||||||||||||||||||||||||||||    
17912445 tttaggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 17912500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 24358612 - 24358667
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
24358612 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24358667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 25705453 - 25705398
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
25705453 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 25705398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 33575748 - 33575803
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
33575748 tttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 33575803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 42695868 - 42695919
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
42695868 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 42695919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 43597150 - 43597205
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||  ||||||||||| ||||||||||||||||||    
43597150 tttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc 43597205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 44985617 - 44985672
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| |||||||| |||||||||| ||||||||||| ||||||||||||||||||    
44985617 tttagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 44985672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 10664981 - 10665035
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||| | ||||||    
10664981 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtc 10665035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 20939324 - 20939274
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
20939324 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 20939274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 23990193 - 23990143
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcac 236  Q
    ||||||| ||||||||||  |||||||||||||||||||||||||||||||    
23990193 taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcac 23990143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 43592043 - 43592097
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
43592043 ttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 43592097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9195208 - 9195155
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||| | ||||||||||| ||||||||||||||||||    
9195208 taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtc 9195155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 10374775 - 10374824
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||| |||||||||| ||||||||||| |||||||||||||||||    
10374775 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 10374824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 10671628 - 10671681
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| |||||||||| |||||||||||||||||||    
10671628 taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtc 10671681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 16523327 - 16523274
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
16523327 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 16523274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 27311071 - 27311018
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
27311071 taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc 27311018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 35155298 - 35155343
Alignment:
189 aatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||    
35155298 aatatggttttagtccctgcaaatatgtctcgttttggttttagtc 35155343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| ||||||||||||||||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 44559358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| |||||    
45442315 aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2265398 - 2265346
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | ||||||||  |||||||||||||||||||||||||||||    
2265398 aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc 2265346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 2481558 - 2481506
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
2481558 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 2481506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3837932 - 3837984
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| |||||||||||||||||||| |||||||||    
3837932 aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtc 3837984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4423894 - 4423946
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
4423894 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 4423946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8046328 - 8046380
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
8046328 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 8046380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14003743 - 14003691
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
14003743 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 14003691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15842824 - 15842772
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
15842824 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 15842772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16522990 - 16523042
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
16522990 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 16523042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 16673410 - 16673462
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
16673410 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 16673462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 17302144 - 17302092
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||  ||||||||||||||||||||||||||||||    
17302144 aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc 17302092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 17541381 - 17541433
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| | ||||||||| ||||||||||||||||||    
17541381 aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc 17541433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25954114 - 25954166
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| |||||||||||| |||||||||||||||||    
25954114 aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtc 25954166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 26238816 - 26238864
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||||||||||||| ||||||||    
26238816 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 26238864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29859873 - 29859821
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
29859873 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 29859821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||    
33733241 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 33733193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37228732 - 37228784
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||| |||||||||||||||||    
37228732 aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc 37228784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38731828 - 38731880
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| ||||||||||| ||||||||||||||||||    
38731828 aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 38731880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 42358702 - 42358750
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
42358702 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 42358750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43597500 - 43597448
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| |||| |||||||||||||||||||||||||    
43597500 aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc 43597448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44073808 - 44073756
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
44073808 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 44073756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 44994062 - 44994010
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || |||||||||||||||||||| |||||||||    
44994062 aggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc 44994010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45442697 - 45442645
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | ||||||||  |||||||||||||||||||||||||||||    
45442697 aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc 45442645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 146690 - 146639
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||| |||||||||||||||||    
146690 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 146639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1138363 - 1138308
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||  || |||||||||||||||||||| |||||||||    
1138363 tttaggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtc 1138308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 3671192 - 3671141
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||| |||||||||| ||||||||||| ||||||||||||||||||    
3671192 ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 3671141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4042890 - 4042839
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||  ||| ||||||||||||||||||||||||||||||    
4042890 ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtc 4042839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 4794130 - 4794181
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||  || ||||||||||||||||||||||||||||||    
4794130 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 4794181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5334751 - 5334802
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
5334751 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 5334802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5335040 - 5334989
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
5335040 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 5334989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 5790558 - 5790609
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||| |||||| ||||||||||| ||||||||||||||||||    
5790558 ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtc 5790609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 7814741 - 7814686
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||||||| ||||||||||| ||| ||||||||||||||    
7814741 tttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtc 7814686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8046648 - 8046597
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| || |||||||| ||||||||||||||||||    
8046648 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc 8046597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 180 - 235
Target Start/End: Complemental strand, 13215368 - 13215313
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    ||||||||||||| || ||| ||| |||||||||||||||||||||||||| ||||    
13215368 ttaggctaaaatatgggtttggtccctgcaaatatgtctcgttttggttttggtca 13215313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 14003405 - 14003460
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
14003405 tttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 14003460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 20131681 - 20131630
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
20131681 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 20131630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 27310875 - 27310922
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||    
27310875 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt 27310922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 36806892 - 36806845
Alignment:
187 aaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||||| ||| ||||||||||||||||||||||||||||||    
36806892 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 36806845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 36815836 - 36815785
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||| |||  ||||||||||||||||||||||||||||    
36815836 aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagt 36815785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 41694003 - 41693952
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
41694003 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 41693952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 146323 - 146377
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| |||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
146323 ttagactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 146377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 3671000 - 3671054
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| ||||||||||  |||||||||| ||||||||| ||||||||    
3671000 ttaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtc 3671054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 3838263 - 3838213
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| |||||||||||  |||||||||||||||||    
3838263 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 3838213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 15842458 - 15842512
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
15842458 ttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 15842512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 16673774 - 16673720
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
16673774 ttaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc 16673720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 230
Target Start/End: Complemental strand, 20658412 - 20658362
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    ||||||||||||| ||||||| || ||||||||||||||||||||| ||||    
20658412 ttaggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt 20658362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29865222 - 29865272
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
29865222 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 29865272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 32691311 - 32691361
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||||||||  ||||||||||| |||||||||||||||    
32691311 taggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta 32691361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 3832639 - 3832586
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||| ||| |||||||||||| |||||||||||||||||    
3832639 taggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 3832586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 11943543 - 11943588
Alignment:
188 aaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||| ||||||||||| ||| ||||||||||||||||||||||||    
11943543 aaatatggttttagtcaatgcgaatatgtctcgttttggttttagt 11943588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 20658059 - 20658112
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||||| ||||||||||| || |||||||||||||||    
20658059 taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtc 20658112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26709694 - 26709747
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||  ||||||||||||||||||||||| ||||||    
26709694 taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc 26709747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29865513 - 29865460
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  ||||||||||  |||||||||||||||||    
29865513 taggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc 29865460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30215873 - 30215820
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| |||||||||| || ||||||||||||||||    
30215873 taggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtc 30215820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||||| |||||| ||| |||||||||||||||||||| |||||||    
34964159 ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag 34964110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2481192 - 2481244
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||   |||||||||||||||||||||||||||||    
2481192 aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtc 2481244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4042609 - 4042661
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
4042609 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 4042661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7814245 - 7814297
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| ||| ||||||| ||||||||||||||||||    
7814245 aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtc 7814297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||  ||||||||||| ||||||||||||||||||    
17912808 taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc 17912760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 18113088 - 18113140
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| || |||||||||||||||    
18113088 aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtc 18113140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24358946 - 24358894
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
24358946 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 24358894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29859490 - 29859538
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
29859490 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 29859538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30215421 - 30215473
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
30215421 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 30215473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| ||||||| || ||||||||||| |||||||||||||||    
31226077 ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta 31226029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| |||||||||| |||||||||||  ||||||||||||||||    
36622582 ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 36622534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 38979889 - 38979941
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgt-ctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||| | ||||||||||||||||||    
38979889 ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtc 38979941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40301974 - 40302026
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||| |||| |||||||||    
40301974 aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc 40302026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43789193 - 43789141
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||  |||||||||||  |||||||||||||||||    
43789193 aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtc 43789141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| |||||| ||| |||||||||| ||||||||||||||||||    
5006610 taaaatatggttttggtctctgcaaatatatctcgttttggttttagt 5006657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 10665295 - 10665244
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||  ||||||||| |||||||||||  ||||||||||||||||    
10665295 aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagt 10665244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12835325 - 12835376
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||| ||||||||||||||    
12835325 ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtc 12835376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 19831511 - 19831558
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| ||||||||||  ||||||||||| ||||||||||||||||    
19831511 taaaatatggttttagtctttgcaaatatgtttcgttttggttttagt 19831558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 23732039 - 23732090
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | ||||  || ||||||||||||||||||||||||||||||    
23732039 ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtc 23732090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 23732329 - 23732282
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    ||||||||||| |||||| ||| ||||||||||| |||||||||||||    
23732329 aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt 23732282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 27109073 - 27109124
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| || |||||||| ||||||||||||||||||    
27109073 ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtc 27109124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 31225714 - 31225765
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||  ||||||||| ||||||||||| ||||||||| |||||||    
31225714 aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagt 31225765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34317798 - 34317849
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
34317798 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 34317849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||||||| ||||    
41791312 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc 41791261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 188 - 234
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
188 aaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| |||||| ||| || |||||||||||||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagtc 4794422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 4842865 - 4842915
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| |   ||||||||||||||||||||||||||||||    
4842865 gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtc 4842915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 24483401 - 24483451
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| || |||||||  |||||||||| ||||||||||||||||||    
24483401 gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtc 24483451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 224
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgtttt 224  Q
    ||||||||| | |||||||||| ||||||||||||||||||||    
32691636 aggctaaaacatggttttagtccctgcaaatatgtctcgtttt 32691594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 40124966 - 40125016
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| ||| ||||||||||| ||| |||||||||||||    
40124966 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt 40125016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 42696202 - 42696152
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
42696202 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 42696152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Original strand, 43710394 - 43710432
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| || |||||||||||||||||||||||||||    
43710394 ttttagtcccttcaaatatgtctcgttttggttttagtc 43710432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 44993806 - 44993851
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||| |||| ||||| |||||||||||||||||||||||||||    
44993806 ctaaaatatggttgtagtc-ctgcaaatatgtctcgttttggtttta 44993851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||| |||||| ||| ||||||||||| ||||||||||||||    
1137983 ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 1138028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 1497943 - 1497894
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||||| ||  |||||||||| ||||||||||||||||||    
1497943 ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtc 1497894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 13850520 - 13850573
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||  |||||  || |||||||||||||||| |||||||||||||    
13850520 taggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtc 13850573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 14393107 - 14393078
Alignment:
205 ctgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||||||||||||||||||    
14393107 ctgcaaatatgtctcgttttggttttagtc 14393078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 22881946 - 22881917
Alignment:
205 ctgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||||||||||||||||||    
22881946 ctgcaaatatgtctcgttttggttttagtc 22881917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 26707871 - 26707924
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| || ||||||||||   |||||||||||||||||    
26707871 taggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtc 26707924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 29182445 - 29182392
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||| |||||||| | ||||  || |||||||||||||||||||||||||||||    
29182445 ttagactaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt 29182392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 31909480 - 31909428
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
31909480 taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc 31909428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 36815486 - 36815539
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||   | ||| ||||||||||||||||||||||||||    
36815486 taggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtc 36815539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 37911121 - 37911072
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||| ||| |||||||||||  ||||||||||||||    
37911121 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 37911072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 41791020 - 41791069
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||| ||||||| ||| ||||||||||||||    
41791020 ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtc 41791069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 3172019 - 3172071
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||| ||| ||||||||||||||    
3172019 aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtc 3172071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3172533 - 3172481
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| |||  |||||||||| ||||||||||||||||||    
3172533 aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtc 3172481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 16968555 - 16968603
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| || |||||||| || |||||||||||||||    
16968555 taaaatatggttttagtccctacaaatatgccttgttttggttttagtc 16968603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 31326253 - 31326201
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  |||||||||  |||||||||| |||||||| |||||||||    
31326253 aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtc 31326201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32476094 - 32476146
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||| ||||||||||||||    
32476094 aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtc 32476146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 33576075 - 33576039
Alignment:
194 ggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||| ||||||||||||||| ||||||||||    
33576075 ggttttagtccctgcaaatatgtctcattttggtttt 33576039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 35155620 - 35155568
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||| |||||||||| |||||| ||||||||    
35155620 aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtc 35155568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43592381 - 43592329
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| |||| |||||||||| ||||| ||||||||    
43592381 aggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtc 43592329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43672319 - 43672267
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| |||||||||||| | |||||||||||||||    
43672319 aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtc 43672267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43710709 - 43710657
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||| |  |||||||||| ||||||||||||||||||    
43710709 aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtc 43710657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 1e-17; HSPs: 151)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 179 - 241
Target Start/End: Complemental strand, 24955014 - 24954952
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta 241  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| ||||||    
24955014 tttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagta 24954952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 8094477 - 8094530
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
8094477 taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtc 8094530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 29158352 - 29158405
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
29158352 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 29158405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7272419 - 7272471
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
7272419 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 7272471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14238750 - 14238802
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
14238750 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 14238802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 19494117 - 19494169
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||||    
19494117 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19494169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3512270 - 3512215
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
3512270 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 3512215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 10337115 - 10337170
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
10337115 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 10337170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 16789074 - 16789125
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||    
16789074 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 16789125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 25131110 - 25131161
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||    
25131110 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 25131161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 1526174 - 1526121
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
1526174 taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 1526121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 35097326 - 35097379
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35097326 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35097379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35347000 - 35346947
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35347000 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35346947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 40492958 - 40493011
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||  ||||||||||||||||||||||||||||||    
40492958 taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtc 40493011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1525808 - 1525860
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
1525808 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 1525860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7420229 - 7420281
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
7420229 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 7420281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 7420591 - 7420539
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||||||||||||||| ||||||||||||||||||    
7420591 aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtc 7420539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8298976 - 8298924
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
8298976 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8298924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 9496339 - 9496391
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| |||||||||||||||||||||||||||||    
9496339 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 9496391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11019519 - 11019571
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
11019519 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 11019571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14239081 - 14239029
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
14239081 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 14239029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 16644045 - 16643993
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
16644045 aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc 16643993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19494414 - 19494362
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
19494414 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 19494362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22650463 - 22650515
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
22650463 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 22650515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22917563 - 22917615
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
22917563 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 22917615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24187898 - 24187846
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||||||||||||||||||||||    
24187898 aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 24187846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 25600228 - 25600280
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| |||||||||||||||||||||||||||||    
25600228 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25600280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 27341592 - 27341540
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
27341592 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 27341540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32418317 - 32418369
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
32418317 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 32418369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 32725906 - 32725958
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
32725906 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 32725958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 43477162 - 43477214
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
43477162 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 43477214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1778564 - 1778615
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
1778564 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 1778615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7186004 - 7185953
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
7186004 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 7185953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 8298587 - 8298638
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
8298587 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8298638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 11019861 - 11019806
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
11019861 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 11019806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 11976740 - 11976685
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
11976740 tttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 11976685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 14489073 - 14489022
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
14489073 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 14489022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 14495068 - 14495119
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
14495068 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 14495119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15719656 - 15719707
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||| |||||||||||||||||||    
15719656 ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtc 15719707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 16643657 - 16643712
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| || |||||||||||||||    
16643657 tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 16643712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 16789369 - 16789318
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
16789369 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 16789318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 28346762 - 28346707
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
28346762 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 28346707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 33526416 - 33526361
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
33526416 tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 33526361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 34963664 - 34963613
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
34963664 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 34963613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 35346629 - 35346680
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35346629 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35346680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 38930301 - 38930352
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||| |||||||||||||||||||||||||    
38930301 aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt 38930352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42133154 - 42133103
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
42133154 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 42133103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 4473701 - 4473755
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||| ||||||||||||||||||||    
4473701 ttaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc 4473755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 4710223 - 4710169
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
4710223 ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 4710169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||| |||||||||| |||||||||||||||||||||||||||    
10776150 ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10776196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 10776499 - 10776449
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||||    
10776499 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 10776449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| |||||||||||||||||||||||| ||||||||    
23939547 ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt 23939597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 8094843 - 8094790
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
8094843 taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 8094790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 17073805 - 17073858
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
17073805 taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 17073858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 17574465 - 17574412
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
17574465 taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 17574412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 18549199 - 18549252
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
18549199 taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 18549252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 18549571 - 18549522
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||| ||| ||||||||||||||||||||||||||||||    
18549571 ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtc 18549522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 28258243 - 28258190
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||  | ||||||||||||||||||||||||||||||    
28258243 taggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtc 28258190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 32726273 - 32726220
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
32726273 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 32726220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 33636320 - 33636373
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
33636320 taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 33636373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 43727431 - 43727383
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||||||||||||||||||||||||||||||    
43727431 ctaaaatatggttttagtc-ctgcaaatatgtctcgttttggttttagtc 43727383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 1685117 - 1685165
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||||||||||| ||||||||||||||||||    
1685117 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 1685165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2728231 - 2728283
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||||||||||||||||||||||    
2728231 aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 2728283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4017301 - 4017249
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
4017301 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 4017249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| |||||||||||||||    
4375692 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 4375740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 11976372 - 11976424
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
11976372 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 11976424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 13155255 - 13155203
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||||| |||||| ||  |||||||||||||||||||||||||||    
13155255 tttaggctaaaatatggtttttgttcctgcaaatatgtctcgttttggtttta 13155203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 13232201 - 13232249
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
13232201 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 13232249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20984145 - 20984197
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
20984145 aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc 20984197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 20984511 - 20984459
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| || |||||||||||||||||||||||||||    
20984511 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc 20984459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28346393 - 28346445
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
28346393 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 28346445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 29488111 - 29488059
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
29488111 aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc 29488059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 34963299 - 34963351
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
34963299 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 34963351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 35345621 - 35345569
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||||| |||||||||  ||||||||||| |||||||||||||||    
35345621 tttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta 35345569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 37536085 - 37536137
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
37536085 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 37536137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40844532 - 40844484
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| |||||||||| |||||||||||||||||||    
40844532 taaaatatggttttagtccctgcaaatatatctcgttttggttttagtc 40844484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||| ||| |||||||||||||||||||||||||||    
42132864 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 42132912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2728597 - 2728546
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
2728597 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 2728546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 3511902 - 3511957
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| || |||||||| ||||||||||||||||||    
3511902 tttaggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtc 3511957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 184 - 231
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||| |||||||||| ||||||||||| |||||||||||||||    
4016906 gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 4016953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7272751 - 7272700
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||| | ||||||||||| ||||||||||||||||||    
7272751 ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtc 7272700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 7326421 - 7326370
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
7326421 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 7326370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 10540445 - 10540500
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||  ||||| ||| ||||||||||| ||||||||||||||||||    
10540445 tttaggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtc 10540500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 10873280 - 10873229
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
10873280 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc 10873229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 20278061 - 20278006
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||| ||||| ||||||||||||||||||    
20278061 tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtc 20278006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 21064688 - 21064633
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||| ||||| ||||||||||||||||||    
21064688 tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtc 21064633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25131447 - 25131396
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||  ||||||||||| ||||||||||||||||||    
25131447 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc 25131396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 27117749 - 27117804
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||  || ||||||||||||||||||||| ||||||||    
27117749 tttaggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc 27117804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 29158669 - 29158618
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||| || |||||||||| |||||||||||||||||||    
29158669 ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtc 29158618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttt 229  Q
    |||||||||||  ||||||||| |||||||||||||||||||||||||    
30337218 aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt 30337171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 32040071 - 32040126
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | | |||||| |||||||||||| |||||||||||||||||    
32040071 tttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtc 32040126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 35097692 - 35097641
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
35097692 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 35097641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 40066496 - 40066547
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| |||||||||| ||||||||||| |||||||| ||||||||    
40066496 aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagt 40066547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40066820 - 40066769
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| | ||||||||||||||||    
40066820 ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtc 40066769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 40844156 - 40844207
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||||||||||||    
40844156 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 40844207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 42430120 - 42430069
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||| ||||||||||||||    
42430120 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 42430069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 6146517 - 6146567
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
6146517 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 6146567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 6146948 - 6146898
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| |||||||||||  |||||||||||||||||    
6146948 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc 6146898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 6469670 - 6469616
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| | |||| ||||||||||||||||  ||||||||||||||||    
6469670 ttaggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtc 6469616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 10337452 - 10337398
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
10337452 ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc 10337398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24090437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||||| ||||||||||  ||||||||||||||||||| |||||||    
1408005 ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag 1408054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 5357421 - 5357474
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
5357421 taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 5357474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 180 - 233
Target Start/End: Original strand, 6469277 - 6469330
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||||| || ||| ||| ||||||||||| |||||||||||||||||    
6469277 ttaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagt 6469330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 7326084 - 7326137
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| |||  |||||||||| ||||||||||||||||||    
7326084 taggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtc 7326137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 19962993 - 19963046
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||| ||||||  ||||||||||||||||||| |||||||||    
19962993 taggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtc 19963046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 21125718 - 21125767
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||  ||||||||| ||||||||||| |||||||||||||||    
21125718 aggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 21125767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 28399037 - 28398984
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| | |||||||| |||||||||||  |||||||||||||||||    
28399037 taggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtc 28398984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 38930665 - 38930616
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| | |||||||| ||||||||||| |||||||||||||||    
38930665 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta 38930616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1408354 - 1408302
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||| |||| |||||||||    
1408354 aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc 1408302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||||  || ||||||||||||||||||||||||||||||    
2811778 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 2811730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 4376014 - 4375959
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtca 235  Q
    |||||||||||||| |||||||||| |||||||||||  ||| ||||||||||||||    
4376014 tttaggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtca 4375959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4474045 - 4473993
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
4474045 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 4473993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 9175011 - 9175063
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| |||  |||||||||||||||||||||||||||||    
9175011 aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtc 9175063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9496724 - 9496672
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
9496724 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 9496672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10540783 - 10540731
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
10540783 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 10540731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||| ||||||||||| ||||||||| |||||    
10755528 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta 10755480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 10872914 - 10872966
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
10872914 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 10872966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14488715 - 14488767
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| ||| ||||||| ||||||||||||||||||    
14488715 aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc 14488767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14496815 - 14496867
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||  |||||||||||  |||||||||||||||||    
14496815 aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtc 14496867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20277691 - 20277743
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
20277691 aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc 20277743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21064318 - 21064370
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
21064318 aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc 21064370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 24187568 - 24187620
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || |||||||||||  |||||||||||||||||    
24187568 aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc 24187620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 24815069 - 24815017
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| | | ||||||||||||||| ||||||||||||||    
24815069 aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtc 24815017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25600598 - 25600546
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||| ||| |||||||||||||| |||||||||||||||    
25600598 aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtc 25600546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28323848 - 28323900
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||| ||||| |||||||||||  |||||||||||||||||    
28323848 aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtc 28323900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28324182 - 28324130
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| || ||||||||||| |||||||||||||||    
28324182 aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtc 28324130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 1162909 - 1162960
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  |||||||| ||||||||    
1162909 ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtc 1162960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4621354 - 4621303
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  ||||| ||| ||||||||||| ||||||||||||||||||    
4621354 ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtc 4621303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 9175375 - 9175320
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| |||||| ||| ||| ||||||| ||||||||||||||||||    
9175375 tttaggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 9175320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 14495389 - 14495339
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| ||| |||||| | ||||||||| ||||||||||||||||||    
14495389 gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtc 14495339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29487750 - 29487801
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| |||||||||||| |||||||||||||||||    
29487750 ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtc 29487801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 33526052 - 33526103
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||  ||| |||||||||||||    
33526052 ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc 33526103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||| |||||| ||| |||||||| ||||||||||||||||||    
36044791 gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta 36044744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 37536419 - 37536368
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
37536419 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 37536368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 44998263 - 44998212
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||  || || |||||||||||||||||||||||||||    
44998263 ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtc 44998212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| ||| ||||||||||| ||| |||||||||||||    
13232562 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt 13232512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||| ||||||  || |||||||||||||||||||||||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 13779197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 21126024 - 21125970
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||  |||||||||  || ||||||| ||||||||||||||||||    
21126024 ttaggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtc 21125970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 14848168 - 14848139
Alignment:
205 ctgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||||||||||||||||||||    
14848168 ctgcaaatatgtctcgttttggttttagtc 14848139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 27117977 - 27117920
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactag 239  Q
    ||||||||||| |||||| ||| ||||||||||| ||| |||||||||| ||| ||||    
27117977 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccctag 27117920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 35115641 - 35115592
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||||||||| |||||||||| || |||||||  ||||||||||||||    
35115641 taggctaaaatatggttttagtccctacaaatatacctcgttttggtttt 35115592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35143846 - 35143793
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||| ||  || ||||||| ||||||||||||||||||    
35143846 taggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtc 35143793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 228
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtt 228  Q
    |||||||||  |||||||||| ||||||||||| ||||||||||||    
40493157 ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt 40493112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 1778917 - 1778881
Alignment:
195 gttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||| ||| |||||||||||||||||||||||||||    
1778917 gttttggtccctgcaaatatgtctcgttttggtttta 1778881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 234
Target Start/End: Complemental strand, 2356225 - 2356197
Alignment:
206 tgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||||||||||||||||||    
2356225 tgcaaatatgtctcgttttggttttagtc 2356197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 234
Target Start/End: Original strand, 4709929 - 4709957
Alignment:
206 tgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||||||||||||||||||    
4709929 tgcaaatatgtctcgttttggttttagtc 4709957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||| || ||| ||| ||||||||||| ||||||||||||||||    
13779531 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag 13779483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 28497254 - 28497306
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||| |||||||| |||||||||    
28497254 aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtc 28497306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 28497616 - 28497568
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
28497616 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 28497568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
29991918 taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc 29991966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 1e-17; HSPs: 179)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 179 - 241
Target Start/End: Original strand, 3151746 - 3151808
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcactagta 241  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||||||||||||| ||||||    
3151746 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagta 3151808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 34238595 - 34238649
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
34238595 ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 34238649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22008525 - 22008577
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
22008525 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 22008577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 22016043 - 22016095
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
22016043 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 22016095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 30130156 - 30130208
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||||    
30130156 taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 30130208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39288572 - 39288624
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
39288572 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 39288624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 39436717 - 39436769
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
39436717 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 39436769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3152115 - 3152060
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
3152115 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 3152060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3830520 - 3830465
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
3830520 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 3830465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 12740903 - 12740958
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
12740903 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 12740958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 22155925 - 22155980
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
22155925 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 22155980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 31869960 - 31869905
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| |||||||||||||||||||| |||||||||    
31869960 tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc 31869905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 51550450 - 51550395
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
51550450 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 51550395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 53701663 - 53701612
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
53701663 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 53701612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 21159821 - 21159767
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||||||||||||    
21159821 tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 21159767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||    
4814539 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 4814588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28427243 - 28427296
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||  ||||||||||||||||||||||||||||||    
28427243 taggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtc 28427296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29446208 - 29446155
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| |||||||||||||| |||||||||||||||    
29446208 taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc 29446155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 29490745 - 29490692
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
29490745 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 29490692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 37506865 - 37506918
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
37506865 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 37506918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 47336583 - 47336530
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
47336583 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 47336530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 54608865 - 54608812
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
54608865 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 54608812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 474043 - 474095
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
474043 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 474095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 474410 - 474358
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| |||||||||||||||||||||||||||||    
474410 taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 474358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4513262 - 4513314
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
4513262 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 4513314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4513621 - 4513569
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
4513621 aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtc 4513569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4814899 - 4814848
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
4814899 aggctaaaatatggttttagtc-ctgcaaatatgtctcgttttggttttagtc 4814848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 4950036 - 4950088
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
4950036 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 4950088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 12741272 - 12741220
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
12741272 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 12741220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 20612899 - 20612847
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
20612899 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 20612847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 21159452 - 21159504
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
21159452 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 21159504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28427609 - 28427557
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
28427609 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 28427557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29525104 - 29525156
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||||||||||| |||||||||    
29525104 aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc 29525156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37507223 - 37507171
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
37507223 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 37507171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 39437110 - 39437058
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
39437110 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 39437058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 46901102 - 46901154
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| |||||||||||| ||||||||||||||||    
46901102 taggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt 46901154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51834607 - 51834659
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
51834607 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 51834659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 4034717 - 4034768
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
4034717 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 4034768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 9863404 - 9863353
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
9863404 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtc 9863353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10976978 - 10977029
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
10976978 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 10977029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 15979705 - 15979650
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| || |||||||||||||||||||||||||||    
15979705 tttaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc 15979650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 25710870 - 25710819
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
25710870 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 25710819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 26090078 - 26090027
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
26090078 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 26090027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 39288902 - 39288847
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
39288902 tttaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 39288847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40169654 - 40169603
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
40169654 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 40169603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 51834946 - 51834891
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
51834946 tttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 51834891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 3830131 - 3830185
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
3830131 ttaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 3830185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 22156292 - 22156242
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
22156292 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 22156242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 25710507 - 25710561
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||| |||||||||| ||||||||||||||||||||| ||||||||    
25710507 ttaggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 25710561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 28552386 - 28552332
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
28552386 ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 28552332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 29955670 - 29955616
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| ||||| |||||||||| ||||||||||| |||||||||||||||||    
29955670 tttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 29955616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 30004825 - 30004771
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| ||||| |||||||||| ||||||||||| |||||||||||||||||    
30004825 tttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 30004771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 30128280 - 30128334
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||||| |||||| ||| ||||||| |||||||||||||||||||||    
30128280 tttaggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagt 30128334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 43441270 - 43441320
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| ||| |||||||||||||||||||||||||||||    
43441270 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 43441320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 7518449 - 7518396
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||| |||||||| ||||||| || |||||||||||||||||||||||||||||    
7518449 ttagactaaaatatggttttactccctgcaaatatgtctcgttttggttttagt 7518396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 8510539 - 8510478
Alignment:
173 gaaaagtttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||||| | |||| |||||||||| |||||||||||| |||||||||||||||||    
8510539 gaaaagattaggcaacaatatggttttagtccctgcaaatatgtttcgttttggttttagtc 8510478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 9262157 - 9262104
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
9262157 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 9262104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 50196301 - 50196350
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||||||||||| ||||||||||||||||||    
50196301 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 50196350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 51550080 - 51550133
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
51550080 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 51550133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3387605 - 3387553
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
3387605 aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtc 3387553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5345690 - 5345638
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
5345690 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 5345638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 13584368 - 13584316
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||||||||||    
13584368 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 13584316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 14633890 - 14633838
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| || |||||||||| |||||||||||||| |||||||||||||||    
14633890 aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtc 14633838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 20611019 - 20611071
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
20611019 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 20611071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 25615974 - 25616026
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
25615974 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 25616026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 26799887 - 26799939
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||| ||||||| ||||||||||||||||||    
26799887 aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc 26799939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 28942523 - 28942575
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| ||||||||||| || ||||||||||||||    
28942523 taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 28942575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 28942906 - 28942854
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||  ||||||||||| ||||||||||||||||||    
28942906 aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc 28942854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30130505 - 30130453
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| ||||| |||||||||||||||||||||| ||| ||||||||||||||    
30130505 aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtc 30130453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 30268504 - 30268556
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
30268504 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 30268556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 30552479 - 30552427
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  |||||||||  |||||||||||||||||||||||||||||    
30552479 aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtc 30552427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 31480135 - 31480187
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
31480135 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 31480187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 35569133 - 35569085
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
35569133 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 35569085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 40169343 - 40169395
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||||||||||||| ||||||||    
40169343 aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtc 40169395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 43440494 - 43440546
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  ||||||||||||||||||| |||||||||    
43440494 aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc 43440546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 45002019 - 45002071
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||| ||| ||||||||||| |||||||||||||||||    
45002019 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 45002071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45002386 - 45002334
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
45002386 aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc 45002334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 45161116 - 45161164
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||| |||| ||||||||||||||||||||||||||||||    
45161116 taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtc 45161164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 45320980 - 45320928
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
45320980 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 45320928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 46186772 - 46186720
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
46186772 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 46186720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 46751270 - 46751322
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || ||||||||||| ||||||||||||||||||    
46751270 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc 46751322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47005153 - 47005205
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||||||||||| |||||||||    
47005153 aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtc 47005205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||||||||||||||||||||||    
47114486 aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 47114538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 51500686 - 51500634
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||| ||||| ||||||||||| ||||||||||||||||||    
51500686 aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtc 51500634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 51759818 - 51759870
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||| ||||  ||||||||||||||||||||||||||||||    
51759818 aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtc 51759870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 52342584 - 52342532
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
52342584 aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtc 52342532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 54608517 - 54608569
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
54608517 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 54608569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 8510214 - 8510265
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||| ||||||||||||||    
8510214 ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtc 8510265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 13514581 - 13514526
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||| ||  ||||||||||||||||||||||||||||||    
13514581 tttaggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtc 13514526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||| |||||||||| ||||||||||| ||||||||||||||||    
14633547 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag 14633594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15016388 - 15016439
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| || |||||||||||||||    
15016388 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 15016439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16123139 - 16123190
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||| ||||||| ||||||||||||||||||    
16123139 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc 16123190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 22008890 - 22008839
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
22008890 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 22008839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 28452143 - 28452198
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| |||  ||||||||||||| |||||||||||||||    
28452143 tttaggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtc 28452198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29445954 - 29446005
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
29445954 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 29446005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| |||||||||||||| ||||| |||||||||    
30424628 ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc 30424679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||| | |||| ||| |||||||||||||||||||||||||||||    
35177254 aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 35177305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 40370589 - 40370538
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
40370589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 40370538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 40545560 - 40545615
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
40545560 tttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtc 40545615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 47005523 - 47005468
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||  ||||||||||||||||||    
47005523 tttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtc 47005468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 49323782 - 49323833
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
49323782 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 49323833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 53113442 - 53113497
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtcact 237  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||| |||| ||||||    
53113442 aggctaaaatatggttttggtccctgcaaatatgtctcgttttgtttttggtcact 53113497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||||||| ||||||||||| || |||||||||||||||    
3361817 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 3361767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 32119217 - 32119271
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||  ||||| ||| |||||||||||||||||||| |||||||||    
32119217 ttaggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtc 32119271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 44802282 - 44802332
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||||||| |||||||||||  ||||||||||||||||    
44802282 ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagt 44802332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 275442 - 275495
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| |||||| |||| ||||||||| ||||||||    
275442 taggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtc 275495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9603627 - 9603680
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
9603627 taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 9603680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 28552019 - 28552072
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| |||||||| |||||||||    
28552019 taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc 28552072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 29955300 - 29955349
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
29955300 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 29955349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 30004454 - 30004503
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
30004454 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc 30004503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30034474 - 30034421
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  ||  |||||||||||||||||||||||||||||    
30034474 taggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtc 30034421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 30106222 - 30106169
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||  ||||||||||||||||||    
30106222 taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc 30106169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 31869596 - 31869645
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||||| |  ||||||||||||||||||||||||||||||    
31869596 ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtc 31869645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 36672961 - 36673014
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||| ||| |||||||||||||| |||||||||||||||    
36672961 taggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc 36673014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 40979711 - 40979662
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| ||||||| || ||||||||||| |||||||||||||||    
40979711 aggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta 40979662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 46622131 - 46622078
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| |||  ||||||||||| |||||||||||||||||    
46622131 taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtc 46622078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 49324148 - 49324095
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||| ||| ||| ||||||||||||||||||||||||||    
49324148 taggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc 49324095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 50196659 - 50196606
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| || |||||||| |||||||| |||||||||    
50196659 taggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtc 50196606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 51500396 - 51500449
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||| ||||| ||| ||||||| ||||||||||||||||||    
51500396 taggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc 51500449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1721453 - 1721401
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
1721453 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 1721401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 3387268 - 3387316
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||||  || ||||||||||||||||||||||||||||||    
3387268 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 3387316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 7518089 - 7518141
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||| |||||| ||||||||||| |||||||| |||||||||    
7518089 aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtc 7518141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 8940522 - 8940474
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
8940522 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 8940474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 10977342 - 10977290
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| || |||| || ||||||||||| ||||||||||||||||||    
10977342 aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtc 10977290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 12673643 - 12673695
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||||||| ||| ||||||| ||||||||||||||||||    
12673643 aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtc 12673695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 14772210 - 14772262
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
14772210 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 14772262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||| || |||||||||||  |||||||||||||||||    
15286155 aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc 15286207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 19656540 - 19656592
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||| ||||||||    
19656540 aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtc 19656592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 19844582 - 19844530
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
19844582 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 19844530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 20757403 - 20757451
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| | |||||||| ||||||||||| ||||||||||||||||||    
20757403 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 20757451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 32119585 - 32119533
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
32119585 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 32119533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 34238916 - 34238864
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| | |||||||||  |||||||||||||||||    
34238916 aggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtc 34238864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 38232240 - 38232292
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||| ||| ||||||||||||||||||||| ||||||||    
38232240 aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtc 38232292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 43441604 - 43441552
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||| ||||||||||||||||||    
43441604 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc 43441552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47336227 - 47336279
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
47336227 aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 47336279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 48924241 - 48924189
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||| ||||||| ||||||||||||||||||    
48924241 aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 48924189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||| |||| ||||| ||||||||||| ||||||||||||||||    
51760117 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag 51760069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 52342191 - 52342243
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||||| |||||| ||| ||||||||||| ||| |||||||||||    
52342191 tttaggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta 52342243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 863277 - 863332
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| | |||| |||  ||||||||||||||||||| |||||||||    
863277 tttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtc 863332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 1721085 - 1721140
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| ||||||| |||||| |||  |||||||||||||| ||||||||||||||    
1721085 tttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtc 1721140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 9261789 - 9261840
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| ||||||||||| ||||||||||||||||||    
9261789 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 9261840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 15979338 - 15979389
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
15979338 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 15979389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 18175791 - 18175830
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgtt 222  Q
    |||||||||| |||||||||| ||||||||||||||||||    
18175791 ggctaaaatatggttttagtccctgcaaatatgtctcgtt 18175830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 26089730 - 26089781
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
26089730 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 26089781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 30426226 - 30426176
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||| ||||||||    
30426226 ggctaaaatatggttttagtc-ctgcaaatatgcctcgttttgattttagtc 30426176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31480500 - 31480449
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| || ||| ||| ||||||||||| ||||||||||||||||||    
31480500 ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtc 31480449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    |||||||| |||||| ||| |||||||||||||| |||||||||||||    
35533281 ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag 35533328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 45521833 - 45521786
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| ||||||||||  ||||||||||| ||||||||||||||||    
45521833 taaaatatggttttagtctttgcaaatatgtttcgttttggttttagt 45521786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 50261936 - 50261885
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||  ||||||||| |||||||||||| || ||||||||||||||    
50261936 ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc 50261885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 4035053 - 4035003
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| |||||| ||| ||||||||||| |||||||| ||||||||    
4035053 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagt 4035003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 9596759 - 9596809
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| |||||||||||  |||||||||||||||||    
9596759 gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtc 9596809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 9603921 - 9603871
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||||| ||| ||||||||||| ||| |||||||||||    
9603921 taggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta 9603871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 11463233 - 11463283
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||  ||||||||||| ||||||||||||||||||    
11463233 gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtc 11463283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 21553888 - 21553938
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttag 232  Q
    ||||||||||| |||||| ||| ||||||||||| |||||||| |||||||    
21553888 aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag 21553938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 25610129 - 25610079
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||| ||||||||    
25610129 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc 25610079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 27681684 - 27681634
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||| | ||| ||||||||||| |||||||||||||||    
27681684 taggctaaaatatggttctggtctctgcaaatatgcctcgttttggtttta 27681634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 28452379 - 28452325
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||| |||||| ||| || ||||||||  |||||||||||||||||    
28452379 ttaggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtc 28452325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 30552144 - 30552197
Alignment:
180 ttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||| ||||||| |||||||| | |||||||||||||| |||||||||||||||    
30552144 ttaggttaaaatatggttttagac-ctgcaaatatgtcttgttttggttttagtc 30552197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 40370285 - 40370335
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||| | |||| ||| |||||||||||||||||||| ||||||||    
40370285 ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagt 40370335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 43440774 - 43440736
Alignment:
196 ttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| ||||||||||| ||||||||||||||||||    
43440774 ttttagtccctgcaaatatgcctcgttttggttttagtc 43440736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 45006247 - 45006201
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||  ||||||||| ||||||||||| |||||||||||||||    
45006247 ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 45006201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 46186410 - 46186460
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||| | |||||||| ||||||||||| ||||||||| ||||||||    
46186410 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc 46186460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 7588316 - 7588369
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||||  ||||| ||| ||||||||||| || |||||||||||||||    
7588316 taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc 7588369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 9863045 - 9863097
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| |||||||||| |||||| |||| ||||||||||||||||||    
9863045 taggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtc 9863097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 20907459 - 20907406
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||| ||||||| ||||||| || ||||||||||| ||| ||||||||||||||    
20907459 taggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtc 20907406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 35407792 - 35407739
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| ||||||  || |||||||||||||| ||||| |||||||||    
35407792 taggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtc 35407739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 863649 - 863601
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| |||||||||||| |||||||| ||||||||    
863649 taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtc 863601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||| |||||| ||| ||||||||||| ||| |||||||||||||    
2486581 ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt 2486629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 4322186 - 4322138
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||  ||||| ||| |||||||||||||| |||||||||||||||    
4322186 taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtc 4322138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9597096 - 9597044
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || |||||||||||  |||||||||||||||||    
9597096 aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtc 9597044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 25610060 - 25610024
Alignment:
194 ggttttagtcactgcaaatatgtctcgttttggtttt 230  Q
    |||||| ||| ||||||||||||||||||||||||||    
25610060 ggttttggtccctgcaaatatgtctcgttttggtttt 25610024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29678023 - 29678075
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||  ||||| |||  |||||||||| ||||||||||||||||||    
29678023 aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtc 29678075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 29686543 - 29686595
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||| |||| |||||| |||  ||||||||||||| |||||||||||||||    
29686543 aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtc 29686595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35565507 - 35565559
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||  || ||||||||||  ||||||||||||||||||    
35565507 aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtc 35565559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 231
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||| |||||||||  ||||||||||| ||||||||| |||||    
39072213 ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta 39072165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 40545836 - 40545788
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| | |||| ||| ||||||||||||||| ||||||||||||||    
40545836 taaaatatgattttggtccctgcaaatatgtctcattttggttttagtc 40545788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 45005889 - 45005937
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| ||||||  || ||||||||||||||||||||| ||||||||    
45005889 taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtc 45005937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 47901803 - 47901851
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||||||| ||| |||||||  |||||||||||||||||    
47901803 taaaatatggttttagtctctggaaatatgcatcgttttggttttagtc 47901851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 49670803 - 49670751
Alignment:
183 ggctaaaatagggttttagtcac-tgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| | ||||||||||  |||||||||||||||||    
49670803 ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtc 49670751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 1310 - 1362
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
1310 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 1362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 1645 - 1593
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |  ||||||| ||||||||||| ||||||||||||||||||    
1645 aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtc 1593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 290 - 238
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
290 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12525 - 12576
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
12525 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 12576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 3295 - 3240
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||| || ||||||||||||||||||||||||||||||    
3295 tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc 3240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 27368 - 27313
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
27368 tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 27313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 3532 - 3583
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
3532 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 3583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 3919 - 3867
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||  |||||||||||||||||    
3919 aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc 3867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 14695 - 14748
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
14695 taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 14748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15013 - 14961
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||| ||||||||||||||    
15013 aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc 14961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 2777 - 2829
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
2777 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 2829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8329 - 8381
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
8329 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 8381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 8643 - 8591
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||    
8643 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 8591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 5709 - 5657
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| |||||||||||||| |||||||||||||||    
5709 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc 5657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 5398 - 5450
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| || |||||||||||||||    
5398 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 5450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 10517 - 10465
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    |||||||||||| |||||||||| |||||||||||||| ||||||||||||||    
10517 taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt 10465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 10168 - 10219
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| || |||||||||||||||    
10168 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc 10219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47924 - 47976
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
47924 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 47976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 223176 - 223121
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| |||||||||||||||  |||||||||||||    
223176 tttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtc 223121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||| ||| ||||||||||||||    
48228 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 48180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 366274 - 366222
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
366274 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 366222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 365979 - 366030
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||||||| ||  |||||||||| ||||||||||||||||||    
365979 ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtc 366030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 9028 - 8977
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
9028 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 8977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 8734 - 8783
Alignment:
185 ctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||| |||||||||| ||||||||||| ||||||||||||||||||    
8734 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc 8783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 75355 - 75410
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||  || ||||||||||||||||||||||||||||||    
75355 tttaggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtc 75410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 75768 - 75713
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
75768 tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 75713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 148282 - 148231
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||||||||    
148282 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 148231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 5208 - 5257
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||    
5208 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 5257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 5228 - 5277
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||    
5228 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 5277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 4081 - 4028
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| |||||||||||||||||||| |||||||||    
4081 taggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc 4028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 82708 - 82655
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||| |||||| ||| ||||||||||| ||||||||||||||||||    
82708 taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 82655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 82340 - 82392
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| ||||||||| ||||||||||||||||||||    
82340 aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc 82392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 8546 - 8598
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
8546 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 8598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 50075 - 50027
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
50075 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 50027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 54814 - 54866
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| ||||||||||  |||||||||| ||||||||||||||||||    
54814 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc 54866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 55176 - 55128
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||| |||||| ||| ||||||||||||||||||||||||||||||    
55176 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 55128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 2664 - 2609
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||| ||| ||||||||||| || |||||||||||||||    
2664 tttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtc 2609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 4312 - 4261
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||||||||| ||||    
4312 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtc 4261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 234
Target Start/End: Original strand, 4020 - 4060
Alignment:
194 ggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| || |||||||| ||||||||||||||||||    
4020 ggttttagtccctacaaatatgcctcgttttggttttagtc 4060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34931 - 34982
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| ||| |||||| ||||||||||| ||||||||||||||||||    
34931 ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtc 34982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 18047 - 17992
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| |||||||||| |||| |||||| |||||||||| |||||||    
18047 tttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtc 17992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 12182 - 12233
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| |||||||| |||||||||    
12182 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtc 12233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 12536 - 12485
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
12536 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 12485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||||||  ||||||||  |||||||||||||||||||||||||||||    
3455 ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 94055 - 94105
Alignment:
181 taggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    |||||||||||| |||||||||| || |||||||| |||||||||||||||    
94055 taggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
184 gctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||| |||||||||| || |||||||| |||||||||||||||    
94329 gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0578 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0578
Description:

Target: scaffold0578; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
186 taaaatagggttttagtcactgcaaatatgtctcgttttggttttagt 233  Q
    ||||||| |||||| ||| |||||||||| ||||||||||||||||||    
5067 taaaatatggttttggtctctgcaaatatatctcgttttggttttagt 5020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 16724 - 16775
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| | |||| ||| |||||||||| |||||||||||||||||||    
16724 ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtc 16775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 17966 - 17915
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||||||| ||||||||||| ||||||| ||||| ||||    
17966 ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtc 17915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 35088 - 35033
Alignment:
179 tttaggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||||||| ||||||  ||  | |||||||||||||||||||||||||||    
35088 tttaggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtc 35033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 2883 - 2832
Alignment:
183 ggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    |||||||||| |||||| ||| |||||||||||||||||||||  |||||||    
2883 ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtc 2832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 7265 - 7216
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggtttta 231  Q
    ||||||||||| | |||| ||| |||||||||||||| ||||||||||||    
7265 aggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 7216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 22056 - 22004
Alignment:
182 aggctaaaatagggttttagtcactgcaaatatgtctcgttttggttttagtc 234  Q
    ||||||||||| |||||| ||| || ||||| || ||||||||||||||||||    
22056 aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtc 22004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University