View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13664_low_5 (Length: 241)
Name: NF13664_low_5
Description: NF13664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13664_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 37176327 - 37176539
Alignment:
| Q |
8 |
tcaaactcaaagtaaaactaccctctgcaacaacgttatcagaatcagaaccagaacttgcttcattctcaaacgactcaaacggatatctactattcca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37176327 |
tcaaactcaaagtaaaactaccctctgcaacaacgttatcagaatcaga------acttgcttcattatcaaacgactcaaacggatatctactattcca |
37176420 |
T |
 |
| Q |
108 |
aatctctctacatctcattaaagcatattctctattctcttcatcattgataaccgctctaccaacaacaagtttcgaaaatcttgtctcacaatattct |
207 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37176421 |
aatctctctacatcgcattaacgcatattctctattctcttcatcattgataaccgctctaccaacaacaagtttcgaaaatcttgtctcacaatattct |
37176520 |
T |
 |
| Q |
208 |
ctgtaacttgtatggttca |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37176521 |
ctgtaacttgtatggttca |
37176539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University