View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13664_low_6 (Length: 220)
Name: NF13664_low_6
Description: NF13664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13664_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 35401609 - 35401722
Alignment:
| Q |
18 |
atgaatgtgagaggacttagaattgcacatgtgaagagtcatttgcaggtaatatagctatgcatgtatagaagttgatttatgcacaacactagtgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35401609 |
atgaatgtgagaggacttagaattgcacatgtgaagagtcatttgcaggtaatatagctatgcatgtatagaagttgatttatggacaacactagtgtta |
35401708 |
T |
|
| Q |
118 |
cttaatttagagta |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35401709 |
cttaatttagagta |
35401722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 35848575 - 35848625
Alignment:
| Q |
18 |
atgaatgtgagaggacttagaattgcacatgtgaagagtcatttgcaggta |
68 |
Q |
| |
|
||||||||||||||||| || ||||| ||||| |||||||||||||||||| |
|
|
| T |
35848575 |
atgaatgtgagaggactcagcattgctcatgtcaagagtcatttgcaggta |
35848625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University