View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13664_low_7 (Length: 215)
Name: NF13664_low_7
Description: NF13664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13664_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 25002767 - 25002946
Alignment:
| Q |
16 |
aagaatatcaaagccagcaggaaactgcaaaatcaaatcaacttattagatctctctcaactctcaccaacttcttctccctcttctccaccacaacaga |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25002767 |
aagaaaatcaaagccagcaggaaactgcaaaatcaaatcaacttattagatctctctcaactctcaccaacttcttctccctcttctccaccacaacaga |
25002866 |
T |
 |
| Q |
116 |
atttggataacgttgttccatgcttcaatccaaccattaaccgccctcgatgcctcgctagaaagaaactctttgctgtt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
25002867 |
atttggataacgttgttccatgcttcaacccaaccattaaccgccctcgatgcctcgctagaaagaaacttttcgctgtt |
25002946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 24998791 - 24998616
Alignment:
| Q |
16 |
aagaatatcaaagccagcaggaaactgcaaaatcaaatcaacttattagatctctct-caactctcaccaacttcttctccctc---ttctccaccacaa |
111 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||||||||||||| ||||| |||| |||||| ||| |||| || ||||||| ||| | |
|
|
| T |
24998791 |
aagaaaatcaaagccaacaggaagctgcaaaatcaaatcaacttattagaactctcaacaacaa-caccaatttcacctccttccttttctccatcacca |
24998693 |
T |
 |
| Q |
112 |
cagaatttggataacgttgttccatgcttcaatccaaccattaaccgccctcgatgcctcgctagaaagaaactctt |
188 |
Q |
| |
|
|||||||||||||| || || || |||||| |||| ||| ||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
24998692 |
cagaatttggataatgtcgtaccttgcttcgatcccacctttaaccgccctcgctgccttgctaggaagaaactctt |
24998616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University