View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13667_high_10 (Length: 344)
Name: NF13667_high_10
Description: NF13667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13667_high_10 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 7 - 335
Target Start/End: Complemental strand, 6002 - 5674
Alignment:
| Q |
7 |
taactcaagggattggagattttgatgagttattgtggttttcggtttcaattgcaggaaaggttaataatggtaatggaaatggtagtttgtgggaggc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6002 |
taactcaagggattggagattttgatgagttattgtggttttcggtttcaattgcaggaaaggttaataatggtaatggaaatggtagtttgtgggaggc |
5903 |
T |
|
| Q |
107 |
ttcagatgagggacaaggtggaggagtttctgctaaattaggaagttcatttaggaaagatgtaggttttttgagtgataattcggatgttgatgttaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5902 |
ttcagatgagggacaaggtggaggagtttctgctaaattaggaagttcatttaggaaagatgtaggttttttgagtgataattcggatgttgatgttaag |
5803 |
T |
|
| Q |
207 |
tccaatgctggtttctcgagggaggatcaaagggattcaggaaggttgaataaggaacgacgtgagaggattctgaatcgttacgaggatggtagggaga |
306 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5802 |
tccaatgctggtttctcgagggaagatcaaagggattcaggaaggttgaataaggaacgacgtgagaggattctgaatcgttacgaggatggtagggaga |
5703 |
T |
|
| Q |
307 |
aaggagtttcggggaacggtgatgatgtc |
335 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |
|
|
| T |
5702 |
aaggagttccggggaacggttatgatgtc |
5674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University