View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13667_high_12 (Length: 322)
Name: NF13667_high_12
Description: NF13667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13667_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 12 - 261
Target Start/End: Complemental strand, 56313227 - 56312980
Alignment:
| Q |
12 |
gagatgaaaggaattaattaatttgtggtcagaatttaaaaattcatgcatgaaatagtacatgtgtatgtatgtatgcgagaaaagnnnnnnnnnnnnn |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
56313227 |
gagatgaaaggaattaattaatttgtggtcagaattttaaaattcatgcatgaaatagtacatgtgtatgtatgtatgcgagagaaggagagagagagag |
56313128 |
T |
 |
| Q |
112 |
nnnnnattaatcacaaacggtgatagttgttgtatgaatatattttaggcactgtttaatttgtactctctttctttctttaatttctatcacgtaataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313127 |
aga--attaatcacaaacggtgatagttgttgtatgaatatattttaggtactgtttaatttgtactctctttctttctttaatttctatcacgtaataa |
56313030 |
T |
 |
| Q |
212 |
ttaattgctcactctctccctcttgcattcttggcttctaactaatttga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313029 |
ttaattgctcactctctccctcttgcattcttggcttctaactaatttga |
56312980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University