View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13667_high_14 (Length: 247)
Name: NF13667_high_14
Description: NF13667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13667_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 235
Target Start/End: Complemental strand, 35195669 - 35195455
Alignment:
| Q |
21 |
ctgcaaacggaagtgtaatccattttttattttattgtgttgaacaatattaggaggtgaactcatcggttgctgaaagaatacgagtttacgacaaaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35195669 |
ctgcaaacggaagtgtaatccattttttattttattatgttgaacaatattaggaggtgaactcatcggttgctgaaagaatacgagtttacgacaaaat |
35195570 |
T |
 |
| Q |
121 |
aaaacactgcagctcagattactcatatatatttcagattatctctttgtttttaatattgaactagtgcaagcttatcttaccaaaaatatatgtctaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35195569 |
aaaacactgcagctcagattactcatatatatttcagattatctctttgtttttaatattgaactagtgcaagcttctcttaccaaaaatatatgtctaa |
35195470 |
T |
 |
| Q |
221 |
tttctgtgtaatttt |
235 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35195469 |
tttctgtgtaatttt |
35195455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University