View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13667_high_9 (Length: 349)
Name: NF13667_high_9
Description: NF13667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13667_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 52913301 - 52912966
Alignment:
| Q |
1 |
gtttggataagagttccgttgggattgacggaaccggaggaacaccagatgttggtttggatgaagagtggtcggaatgtattagaaaagacgtcatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913301 |
gtttggataagagttccgttgggattgacggaaccggaggaacaccagatgttggtttggatgaagagtggtcggaatgtattagaaaagacgtcatatt |
52913202 |
T |
|
| Q |
101 |
caagggagtgagcagtgcaatcatttttaacagcttgctcttgtgggttaacacggcatctaccgttgggtaaagataagtttgagaagccaaaatctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913201 |
caagggagtgagcagtgcaatcatttttcacagcttgctcttgtgggttaacacggcatctaccgttgggtaaagataagtttgagaagccaaaatctgt |
52913102 |
T |
|
| Q |
201 |
acggtcaaaaatgatgacacggtcgttgtgtagtaattgcatatgcatggctacaatgccaatgttgttttgtaagagctgccattgtccaccagcggct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52913101 |
acggtcaaaaatgatgacacggtcgttgtgtagtaattgcatatgcatggctacaatgccaatgttgttttgtaagagctgccattgtccaccagcggct |
52913002 |
T |
|
| Q |
301 |
atagctggagatggaatggtgacggtggttgatatt |
336 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52913001 |
atagctggagatggaatggtgaaggtggttgatatt |
52912966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University