View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13668_low_3 (Length: 377)
Name: NF13668_low_3
Description: NF13668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13668_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 3e-24; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 299 - 364
Target Start/End: Original strand, 27826866 - 27826931
Alignment:
| Q |
299 |
gggaataacattgaattcaactcgccggaaaaaccaaaacttctccagataacgcaactggggttc |
364 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27826866 |
gggaataacactgaattcaactcgccggaaaaaccaaaacttctccggataacgcaactggggttc |
27826931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 299 - 367
Target Start/End: Original strand, 27831446 - 27831514
Alignment:
| Q |
299 |
gggaataacattgaattcaactcgccggaaaaaccaaaacttctccagataacgcaactggggttcatc |
367 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27831446 |
gggaataacactgaactcaactcgccggaaaaaccaaaacttcaccagataacgcaactggggttcatc |
27831514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 198 - 253
Target Start/End: Original strand, 27826765 - 27826820
Alignment:
| Q |
198 |
gaaatattaaagatgtgtttgtaatttttcgtttgtcccatcaattccttaggaag |
253 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27826765 |
gaaatattaaggatatgtttgtaattttttgtttgtcccatcaattccttaggaag |
27826820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 209 - 249
Target Start/End: Original strand, 27831356 - 27831396
Alignment:
| Q |
209 |
gatgtgtttgtaatttttcgtttgtcccatcaattccttag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27831356 |
gatgtgtttgtaatttttcgtttgtcccatcaattccttag |
27831396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University