View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13669_high_13 (Length: 229)
Name: NF13669_high_13
Description: NF13669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13669_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 22 - 212
Target Start/End: Original strand, 4268906 - 4269094
Alignment:
| Q |
22 |
agaagaaaaaaccaagagatctaactacagtgataaaatagtattttgcacttaattgaactcgggacaaaactttgtccactgctttggtgtgcggtac |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4268906 |
agaagaaaaaaacaagagatctaactacagtgataaaatagtattttgcacttaattgaactcgggacaaaactttgtccactgctttggtg--cggtac |
4269003 |
T |
 |
| Q |
122 |
aataaaacggtggttgtccagtccctcgcttcttattttgtgctgtccattgttgccttttttaaatcaaacgatgggcaaatatatttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269004 |
aataaaacggtggttgtccagtccctcgcttcttattttgtgctgtccattgttgccttttttaaatcaaacgatgggcaaatatatttgt |
4269094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University