View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13669_low_12 (Length: 241)
Name: NF13669_low_12
Description: NF13669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13669_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 20526091 - 20526303
Alignment:
| Q |
13 |
aatatgggagtaatgggactaataagtgcttcaactcttcaagacggtgctttcaactttccattagtcgaacatagtataaaagtaaatcgatttgttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526091 |
aatatgggagtaatgggactaataagtgcttcaactcttcaagacggtgctttcaactttccattagtcgaacatagtataaaagtaaatcgatttgttt |
20526190 |
T |
 |
| Q |
113 |
tgttattgctaatgcaaaacaacacgatgaaggcaaaacaatgtgttttgttctagaaattacaaaaaacatcattcactacaatattgttttgactaaa |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526191 |
tgttattgctagtgcaaaacaacacgatgaaggcaaaacaatgtgttttgttctagaaattacaaaaaacatcattcactacaatattgttttgactaaa |
20526290 |
T |
 |
| Q |
213 |
ggagagttgaagt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
20526291 |
ggagagttgaagt |
20526303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University