View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13669_low_16 (Length: 202)
Name: NF13669_low_16
Description: NF13669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13669_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 21 - 184
Target Start/End: Original strand, 43969401 - 43969562
Alignment:
| Q |
21 |
tgagagagaaaggaagaaaaaggtgacatgtggcggaatgacagatagattattagatgtcgtcatnnnnnnncataaatgactgaaagaacatcatttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
43969401 |
tgagagagaaaggaagaaaaaggtgacatgtggcggaatgacagatagattattagatgtcgtcataaaaaa--ataaatgattgaaagaacatcatttt |
43969498 |
T |
 |
| Q |
121 |
cggagacaacacaagaaacacaaaagaaaagggaacaattgactatggaaaactatcatgatac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43969499 |
cggagacaacacaagaaacacaaaagaaaagggaacaattgactatggaaaactatcatgatac |
43969562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University