View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1366_low_3 (Length: 488)
Name: NF1366_low_3
Description: NF1366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1366_low_3 |
 |  |
|
| [»] scaffold1234 (1 HSPs) |
 |  |  |
|
| [»] scaffold0323 (1 HSPs) |
 |  |  |
|
| [»] scaffold0896 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 146 - 459
Target Start/End: Complemental strand, 17838863 - 17838549
Alignment:
| Q |
146 |
gaccttaaatcggtagattgcggaaaatctccttgtaaacataaccacaattttatccatggatgatatatcaagcacttactataaa-catggaatagt |
244 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||| |||| || |
|
|
| T |
17838863 |
gaccttaaatcggtagattgcagaaaatctccttctaaacataaccacaattttatgcatggatgatatatcaagcacttaatataaaacatagaatggt |
17838764 |
T |
 |
| Q |
245 |
gtgaaatattgcatacaattggaagttaaatttgtacatattaacttgatatcttcgaaattaaatctgtgcataataatagtttgttcagaaataaaaa |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17838763 |
gtgaaatattgcatacaattggaagttaaatttgtacatattaacttgatatcttcgaaattaaatatgtgcataataatagtttgttcagaaataaaaa |
17838664 |
T |
 |
| Q |
345 |
tccggaagtttgtatattcattataatttagcatatgggagaaggattaacaatatctaagcagctataggtcgccaatttcgttaaaccaatggttttc |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
17838663 |
tccggaagtttgtatattcattataatttagcatatgggagaaggattaacaatatctaagcagctataggttgccaatttcgttaaaccaatggtcttc |
17838564 |
T |
 |
| Q |
445 |
gcaggatagtggaag |
459 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17838563 |
gcaggatagtggaag |
17838549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 17839285 - 17839238
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17839285 |
actagaccatccacccgtgctgccgcacgggtcatatcgattggaaac |
17839238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 31572503 - 31572465
Alignment:
| Q |
26 |
catccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31572503 |
catccacccgtgctgccgcacgggtcatatacattgtaa |
31572465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 6120781 - 6120745
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6120781 |
actagactttccacccgtgctgccgcacgggtcatat |
6120745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 8700490 - 8700454
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8700490 |
actagactttccacccgtgctgccgcacgggtcatat |
8700454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 18351780 - 18351744
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18351780 |
actagactttccacccgtgctgccgcacgggtcatat |
18351744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 19596363 - 19596399
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19596363 |
actagactttccacccgtgctgccgcacgggtcatat |
19596399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 20545054 - 20545018
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20545054 |
actagactttccacccgtgctgccgcacgggtcatat |
20545018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 27944796 - 27944832
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27944796 |
actagactttccacccgtgctgccgcacgggtcatat |
27944832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 41664739 - 41664703
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41664739 |
actagactttccacccgtgctgccgcacgggtcatat |
41664703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 44902310 - 44902274
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44902310 |
actagactttccacccgtgctgccgcacgggtcatat |
44902274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 27)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 20370358 - 20370400
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20370358 |
actagaccatccacccgtgctgccgcacgggtcatatcgattg |
20370400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 27818318 - 27818365
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
27818318 |
actagaccatcgacccgtgctgccgcacgggtcatctcgattggaaac |
27818365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 13 - 55
Target Start/End: Complemental strand, 54073265 - 54073223
Alignment:
| Q |
13 |
attaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54073265 |
attaacactagactttccacccgtgctgccgcacgggtcatat |
54073223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 146 - 179
Target Start/End: Original strand, 27818445 - 27818478
Alignment:
| Q |
146 |
gaccttaaatcggtagattgcggaaaatctcctt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27818445 |
gaccttaaatcggtagattgcggaaaatctcctt |
27818478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 4584431 - 4584470
Alignment:
| Q |
16 |
aacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4584431 |
aacactagactttccacccgtgctgccgcacgggtcatat |
4584470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 12 - 55
Target Start/End: Complemental strand, 25437329 - 25437286
Alignment:
| Q |
12 |
tattaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
25437329 |
tattaatactagaccttgcacccgtgctgccgcacgggtcatat |
25437286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 1941718 - 1941756
Alignment:
| Q |
17 |
acactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1941718 |
acactagactttccacccgtgctgccgcacgggtcatat |
1941756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 46590274 - 46590312
Alignment:
| Q |
17 |
acactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
46590274 |
acactagaccatccacccgtgctgtcgcccgggtcatat |
46590312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 21 - 55
Target Start/End: Original strand, 53556913 - 53556947
Alignment:
| Q |
21 |
tagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
53556913 |
tagatcatccacccgtgctgccgcacgggtcatat |
53556947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 179
Target Start/End: Complemental strand, 4867070 - 4867037
Alignment:
| Q |
146 |
gaccttaaatcggtagattgcggaaaatctcctt |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
4867070 |
gaccttaaatcggtagattgcagaaaatctcctt |
4867037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 3524330 - 3524358
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3524330 |
ggtagattgcggaaaatctccttgtaaac |
3524358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 3898651 - 3898615
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3898651 |
actagactttccacccgtgctgccgcacgggtcatat |
3898615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 6460168 - 6460204
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6460168 |
actagactttccacccgtgctgccgcacgggtcatat |
6460204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 12264429 - 12264393
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12264429 |
actagactttccacccgtgctgccgcacgggtcatat |
12264393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 21098533 - 21098497
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21098533 |
actagactttccacccgtgctgccgcacgggtcatat |
21098497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 26949027 - 26948991
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26949027 |
actagactttccacccgtgctgccgcacgggtcatat |
26948991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 30761267 - 30761303
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30761267 |
actagaccatccacccgtgctatcgcacgggtcatat |
30761303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 34121584 - 34121548
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34121584 |
actagactttccacccgtgctgccgcacgggtcatat |
34121548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 36076454 - 36076490
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36076454 |
actagactttccacccgtgctgccgcacgggtcatat |
36076490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 28 - 64
Target Start/End: Complemental strand, 37099764 - 37099728
Alignment:
| Q |
28 |
tccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37099764 |
tccacccgtgctgccgcacgggtcatatacattgtaa |
37099728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 38653927 - 38653963
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38653927 |
actagactttccacccgtgctgccgcacgggtcatat |
38653963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 40014653 - 40014689
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40014653 |
actagactttccacccgtgctgccgcacgggtcatat |
40014689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 43363611 - 43363647
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43363611 |
actagactttccacccgtgctgccgcacgggtcatat |
43363647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 44751632 - 44751668
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
44751632 |
actagatcatccacccatgctgccgcacgggtcatat |
44751668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 46590414 - 46590442
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46590414 |
ggtagattgcggaaaatctccttgtaaac |
46590442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 46590674 - 46590702
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46590674 |
ggtagattgcggaaaatctccttgtaaac |
46590702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 49672791 - 49672755
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49672791 |
actagactttccacccgtgctgccgcacgggtcatat |
49672755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 2737178 - 2737136
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2737178 |
actagaccatccacccgtgctgccgcacgggtcatattgattg |
2737136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 64
Target Start/End: Original strand, 33289068 - 33289115
Alignment:
| Q |
17 |
acactagaccatccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33289068 |
acactagatcgtccacccgtgctgccgcacgggtcatatagattgtaa |
33289115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 12597258 - 12597301
Alignment:
| Q |
12 |
tattaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12597258 |
tattaaaactagactttccacccgtgctgccgcacgggtcatat |
12597301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 6300699 - 6300745
Alignment:
| Q |
9 |
tcatattaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||| ||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
6300699 |
tcataataagactagactatgcacccgtgctgccgcacgggtcatat |
6300745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 6307509 - 6307555
Alignment:
| Q |
9 |
tcatattaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||| ||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
6307509 |
tcataataagactagactatgcacccgtgctgccgcacgggtcatat |
6307555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 8657064 - 8657109
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8657064 |
actagatcgtccacccgtgctgccgcacgggtcatatacattgtaa |
8657109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 162669 - 162705
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
162669 |
actagactttccacccgtgctgccgcacgggtcatat |
162705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 2267005 - 2266969
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2267005 |
actagactttccacccgtgctgccgcacgggtcatat |
2266969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 3593122 - 3593086
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3593122 |
actagactttccacccgtgctgccgcacgggtcatat |
3593086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 4096352 - 4096316
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
4096352 |
actagaccatccacccgtgctgtcgcccgggtcatat |
4096316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Complemental strand, 4440188 - 4440160
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4440188 |
ggtagattgcggaaaatctccttgtaaac |
4440160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Complemental strand, 4440448 - 4440420
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4440448 |
ggtagattgcggaaaatctccttgtaaac |
4440420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 4440586 - 4440550
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
4440586 |
actagaccatccacccgtgctgtcgcccgggtcatat |
4440550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 8539782 - 8539746
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8539782 |
actagactttccacccgtgctgccgcacgggtcatat |
8539746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Complemental strand, 28062812 - 28062784
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28062812 |
ggtagattgcggaaaatctccttgtaaac |
28062784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 28062949 - 28062913
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28062949 |
actagaccatccacccgtgctgtcgcccgggtcatat |
28062913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 28099597 - 28099633
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28099597 |
actagactttccacccgtgctgccgcacgggtcatat |
28099633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 33646171 - 33646135
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33646171 |
actagactttccacccgtgctgccgcacgggtcatat |
33646135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000005; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 13951045 - 13950998
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
13951045 |
actagaccatccacccgtgctgtcgcacgggtcatctcgattgaaaac |
13950998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 11001324 - 11001366
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattg |
61 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
11001324 |
actagaccttccacccgtgctgccgcacgggtcatattgattg |
11001366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 64
Target Start/End: Complemental strand, 31097946 - 31097896
Alignment:
| Q |
14 |
ttaacactagaccatccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||| |||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31097946 |
ttaaaactagatcgtccacccgtgctgccgcacgggtcatatacattgtaa |
31097896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 179
Target Start/End: Complemental strand, 13950920 - 13950887
Alignment:
| Q |
146 |
gaccttaaatcggtagattgcggaaaatctcctt |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
13950920 |
gaccttaaatcggtagattgcagaaaatctcctt |
13950887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 8026626 - 8026662
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
8026626 |
actagaccatccacccgtgcggcagcacgggtcatat |
8026662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 13786399 - 13786363
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13786399 |
actagactttccacccgtgctgccgcacgggtcatat |
13786363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 16376545 - 16376581
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16376545 |
actagactttccacccgtgctgccgcacgggtcatat |
16376581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 20392644 - 20392608
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
20392644 |
actagaccatccacccgtgctgtcgcccgggtcatat |
20392608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 20912450 - 20912486
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
20912450 |
actagaccatccacccgtgctgccgcccgagtcatat |
20912486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 20912588 - 20912616
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20912588 |
ggtagattgcggaaaatctccttgtaaac |
20912616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 21342052 - 21342016
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21342052 |
actagactttccacccgtgctgccgcacgggtcatat |
21342016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 21804572 - 21804608
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21804572 |
actagactttccacccgtgctgccgcacgggtcatat |
21804608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 27903417 - 27903453
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27903417 |
actagactttccacccgtgctgccgcacgggtcatat |
27903453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 31373685 - 31373649
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31373685 |
actagactttccacccgtgctgccgcacgggtcatat |
31373649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 33916947 - 33916983
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33916947 |
actagactttccacccgtgctgccgcacgggtcatat |
33916983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 38163339 - 38163375
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38163339 |
actagactttccacccgtgctgccgcacgggtcatat |
38163375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 40969120 - 40969084
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40969120 |
actagactttccacccgtgctgccgcacgggtcatat |
40969084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 42242154 - 42242190
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42242154 |
actagactttccacccgtgctgccgcacgggtcatat |
42242190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000005; HSPs: 16)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 30401632 - 30401679
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
30401632 |
actagaccatccacccgtgctgtcgcacgggtcatctcgattggaaac |
30401679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 30408189 - 30408236
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
30408189 |
actagaccatccacccgtgctgtcgcacgggtcatctcgattggaaac |
30408236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 35165489 - 35165442
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
35165489 |
actagaccatccacccgtgctgtcgcacgggtcatctcgattggaaac |
35165442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 1232025 - 1231979
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaa |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1232025 |
actagactttccacccgtgctgccgcacgggtcatatacattgtaaa |
1231979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 2951366 - 2951412
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaaa |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2951366 |
actagactttccacccgtgctgccgcacgggtcatatacattgtaaa |
2951412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 31018198 - 31018236
Alignment:
| Q |
17 |
acactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31018198 |
acactagactttccacccgtgctgccgcacgggtcatat |
31018236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 52957107 - 52957069
Alignment:
| Q |
17 |
acactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52957107 |
acactagactctccacccgtgctgccgcacgggtcatat |
52957069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 4266610 - 4266574
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4266610 |
actagactttccacccgtgctgccgcacgggtcatat |
4266574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 4325454 - 4325490
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4325454 |
actagaccttgcacccgtgctgccgcacgggtcatat |
4325490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 9216260 - 9216224
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9216260 |
actagactttccacccgtgctgccgcacgggtcatat |
9216224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 18855233 - 18855269
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18855233 |
actagactttccacccgtgctgccgcacgggtcatat |
18855269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 28546769 - 28546797
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28546769 |
ggtagattgcggaaaatctccttgtaaac |
28546797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 28947454 - 28947490
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
28947454 |
actagatcgtccacccgtgctgccgcacgggtcatat |
28947490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 29942247 - 29942211
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29942247 |
actagactttccacccgtgctgccgcacgggtcatat |
29942211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 34888686 - 34888722
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34888686 |
actagactttccacccgtgctgccgcacgggtcatat |
34888722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 38913747 - 38913783
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38913747 |
actagactttccacccgtgctgccgcacgggtcatat |
38913783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1234 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold1234
Description:
Target: scaffold1234; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 1091 - 1047
Alignment:
| Q |
11 |
atattaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1091 |
atattaaaactagaccttgcacccgtgctgccgcacgggtcatat |
1047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0323 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0323
Description:
Target: scaffold0323; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 11828 - 11792
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11828 |
actagaccatccacccgtgctgccgcacgtgtcatat |
11792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 18997929 - 18997893
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18997929 |
actagactatccacccgtgctgccgcacgggtcatat |
18997893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 405354 - 405399
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
405354 |
actagatcgtccacccgtgctgccgcacgggtcatatacattgtaa |
405399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 179
Target Start/End: Original strand, 1598513 - 1598546
Alignment:
| Q |
146 |
gaccttaaatcggtagattgcggaaaatctcctt |
179 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
1598513 |
gaccttaaattggtagattgcggaaaatctcctt |
1598546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 995815 - 995851
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
995815 |
actagactttccacccgtgctgccgcacgggtcatat |
995851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 5769490 - 5769526
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5769490 |
actagaccttgcacccgtgctgccgcacgggtcatat |
5769526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 6299020 - 6299056
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6299020 |
actagactttccacccgtgctgccgcacgggtcatat |
6299056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 10478166 - 10478130
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10478166 |
actagactttccacccgtgctgccgcacgggtcatat |
10478130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 11071961 - 11071997
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
11071961 |
actagaccttgcacccgtgctgccgcacgggtcatat |
11071997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 11145412 - 11145372
Alignment:
| Q |
26 |
catccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
11145412 |
catccacccgtgctgtcgcacgggtcatttcgattggaaac |
11145372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 15961361 - 15961325
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15961361 |
actagactttccacccgtgctgccgcacgggtcatat |
15961325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 18175610 - 18175574
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18175610 |
actagactttccacccgtgctgccgcacgggtcatat |
18175574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 23353622 - 23353658
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23353622 |
actagactttccacccgtgctgccgcacgggtcatat |
23353658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 24471908 - 24471872
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
24471908 |
actagaccttgcacccgtgctgccgcacgggtcatat |
24471872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 30473884 - 30473920
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30473884 |
actagactttccacccgtgctgccgcacgggtcatat |
30473920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 32110861 - 32110897
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32110861 |
actagactttccacccgtgctgccgcacgggtcatat |
32110897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 16)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 13 - 55
Target Start/End: Original strand, 20655043 - 20655085
Alignment:
| Q |
13 |
attaacactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20655043 |
attaatactagactttccacccgtgctgccgcacgggtcatat |
20655085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 4082629 - 4082592
Alignment:
| Q |
18 |
cactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
4082629 |
cactagatcgtccacccgtgctgccgcacgggtcatat |
4082592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 2398942 - 2398978
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2398942 |
actagactttccacccgtgctgccgcacgggtcatat |
2398978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 10729442 - 10729478
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10729442 |
actagactttccacccgtgctgccgcacgggtcatat |
10729478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 16349715 - 16349751
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
16349715 |
actagatcgtccacccgtgctgccgcacgggtcatat |
16349751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 16526306 - 16526342
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16526306 |
actagactttccacccgtgctgccgcacgggtcatat |
16526342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 17373161 - 17373197
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17373161 |
actagactttccacccgtgctgccgcacgggtcatat |
17373197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 20874917 - 20874881
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20874917 |
actagactttccacccgtgctgccgcacgggtcatat |
20874881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 25099236 - 25099272
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
25099236 |
actagatcgtccacccgtgctgccgcacgggtcatat |
25099272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 25158326 - 25158362
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
25158326 |
actagatcgtccacccgtgctgccgcacgggtcatat |
25158362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 34107338 - 34107374
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34107338 |
actagactttccacccgtgctgccgcacgggtcatat |
34107374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 34110881 - 34110845
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34110881 |
actagactttccacccgtgctgccgcacgggtcatat |
34110845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 37713652 - 37713688
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
37713652 |
actagaccatccacccgtgctgtcgcccgggtcatat |
37713688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 37714048 - 37714076
Alignment:
| Q |
157 |
ggtagattgcggaaaatctccttgtaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37714048 |
ggtagattgcggaaaatctccttgtaaac |
37714076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 38246865 - 38246901
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38246865 |
actagactttccacccgtgctgccgcacgggtcatat |
38246901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 40177270 - 40177234
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40177270 |
actagactttccacccgtgctgccgcacgggtcatat |
40177234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 14)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 37590802 - 37590840
Alignment:
| Q |
17 |
acactagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37590802 |
acactagactttccacccgtgctgccgcacgggtcatat |
37590840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 23976706 - 23976751
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23976706 |
actagatcgtccacccgtgctgccgcacgggtcatatatattgtaa |
23976751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 8371080 - 8371116
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8371080 |
actagaccttgcacccgtgctgccgcacgggtcatat |
8371116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 12090459 - 12090495
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12090459 |
actagactttccacccgtgctgccgcacgggtcatat |
12090495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 16904952 - 16904988
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16904952 |
actagactttccacccgtgctgccgcacgggtcatat |
16904988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 18209740 - 18209704
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18209740 |
actagactttccacccgtgctgccgcacgggtcatat |
18209704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 23143178 - 23143222
Alignment:
| Q |
10 |
catattaacactagaccatccacccgtgctgccgcacgggtcata |
54 |
Q |
| |
|
||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
23143178 |
catattacaactagaccttgcacccgtgctgccgcacgggtcata |
23143222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 27707361 - 27707401
Alignment:
| Q |
26 |
catccacccgtgctgccgcacgggtcatatcgattgtaaac |
66 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||| |||| |
|
|
| T |
27707361 |
catccacccgtgctaccgcacgggtcatatctattggaaac |
27707401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 30824922 - 30824958
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30824922 |
actagactttccacccgtgctgccgcacgggtcatat |
30824958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 31965969 - 31966005
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31965969 |
actagactttccacccgtgctgccgcacgggtcatat |
31966005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 33139471 - 33139507
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33139471 |
actagactttccacccgtgctgccgcacgggtcatat |
33139507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 37651895 - 37651859
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37651895 |
actagactttccacccgtgctgccgcacgggtcatat |
37651859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 44376079 - 44376115
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
44376079 |
actagatcgtccacccgtgctgccgcacgggtcatat |
44376115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 52434853 - 52434817
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52434853 |
actagactttccacccgtgctgccgcacgggtcatat |
52434817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0896 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0896
Description:
Target: scaffold0896; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 1146 - 1101
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatatcgattgtaa |
64 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1146 |
actagatcgtccacccgtgctgccgcacgggtcatatacattgtaa |
1101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 46503 - 46467
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46503 |
actagactttccacccgtgctgccgcacgggtcatat |
46467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 149050 - 149086
Alignment:
| Q |
19 |
actagaccatccacccgtgctgccgcacgggtcatat |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
149050 |
actagactttccacccgtgctgccgcacgggtcatat |
149086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University