View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1366_low_4 (Length: 432)
Name: NF1366_low_4
Description: NF1366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1366_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 133 - 421
Target Start/End: Complemental strand, 25049485 - 25049195
Alignment:
| Q |
133 |
acgtcttaatcgtcatggaatggatgaagagggtaatttaaagggatatggataaagaatgaggttagaaaagattgtgctggcaatttcattacattac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049485 |
acgtcttaatcgtcatggaatggatgaagagggtaatttaaagggatatggataaagaatgaggttagaaaagattgtgctggcaatttcattacattac |
25049386 |
T |
|
| Q |
233 |
atatagccggcttaggaatggttgcttctggccgtctgtgaaaccggctctcatgttatgagnnnnnnncttctttcttcctttgtcttttactcacaa- |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25049385 |
atatagccggcttaggaatggttgcttctggccgtctgtgaaaccggctctcatgttatgagtttttttcttctttcttcctttgtcttttactcacaat |
25049286 |
T |
|
| Q |
332 |
-ttgtgttatgtggctttcaaccggttttggaatctgtttgatgtatctgtgactctcttattatataacttcattcaccttttcctctgt |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049285 |
tttgtgttatgtggctttcaaccggttttggaatctgtttgatgtatctgtgactctcttattatataacttcattcaccttttcctctgt |
25049195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University