View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1366_low_9 (Length: 330)
Name: NF1366_low_9
Description: NF1366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1366_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 59 - 301
Target Start/End: Complemental strand, 29104156 - 29103914
Alignment:
| Q |
59 |
tatttaattgacatacgaacgattaaactaatatcttgtnnnnnnnncacaacacaaggaatgtaagactaaatcagattttgtgatgcacaataaaaga |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104156 |
tatttaattgacatacgaatgattaaactaatatcttgtaaaaaaaacacaacacaaggaatgtaagactaaatcagattttgtgatgcacaataaaaga |
29104057 |
T |
|
| Q |
159 |
cacccgatattactttttagtgatcacactgtcacaccagtctcaacggaccaaatttaagtcacctgttctttcatcgactatacaacctacgtattaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104056 |
cacccgatattactttttagtgatcacagtgtcacaccagtctcaacggaccaaatttaagtcacctgttctttcatcgactatacaacctacgtattaa |
29103957 |
T |
|
| Q |
259 |
aaaactatttacatctgttgcttatccttggcgtgtttacttt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103956 |
aaaactatttacatctgttgcttatccttggcgtgtttacttt |
29103914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University