View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13670_low_2 (Length: 238)
Name: NF13670_low_2
Description: NF13670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13670_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 15376487 - 15376685
Alignment:
| Q |
19 |
gttcgaactcattcccaatcatacaatatatttgtgtagnnnnnnnncttcacaataaaatatt-ctctacatccaactgtagagattgattcctcaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||| || |||||||||||| ||||||||||||||||| | |
|
|
| T |
15376487 |
gttcgaactcattcccaatcatacaatatatttgtgtagttttttttttccacaataaaatatttctttacatccaactgcagagattgattcctcaaat |
15376586 |
T |
 |
| Q |
118 |
cggatatgattgtaatagatgataaaatttt-tccttaagataataaacacagttgcattcgtgtaactagatttatcttaacaagtcattcatctata |
215 |
Q |
| |
|
|| ||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15376587 |
cgaatatgattgtaattgatgataaaattttttccttaagataataaacacatttgcatttgtgtaactagatttatcttaacaagtcattcatctata |
15376685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University