View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13671_low_4 (Length: 235)
Name: NF13671_low_4
Description: NF13671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13671_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 29917373 - 29917569
Alignment:
| Q |
19 |
cactgccaagcttggcccatttataatagttatatatagcattgcacaacttagtttggtacgtataaacaactttctcaccgcatttgcagaagaattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29917373 |
cactgccaagcttggcccatttataatagttatatatagcattgcacaacttagtttggtatgtataaacaactttctcaccgcatttgcagaagaattg |
29917472 |
T |
 |
| Q |
119 |
atttgcgttgatagttgcatgtgttggggnnnnnnnnnccaacttcttcaacttcaccatactctgatggacgcccctccaattaagaagcaacgac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29917473 |
atttgcgttgatagttgcatgtgttggggtttttttttccaacttcttcaacttcactatactctgatggacgcccctccaattaagaagcaacgac |
29917569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 78
Target Start/End: Original strand, 24001113 - 24001147
Alignment:
| Q |
44 |
atagttatatatagcattgcacaacttagtttggt |
78 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
24001113 |
atagttatatatagcattgcacaactgagtttggt |
24001147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University