View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_high_23 (Length: 354)
Name: NF13672_high_23
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 95 - 343
Target Start/End: Original strand, 55477273 - 55477521
Alignment:
| Q |
95 |
catcgcttggatgttgtggtggtagtgatggttaaaccatcggttatggcaggggatgagttgggttcttgaacagggtcgtgtttgttttgggtggaaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55477273 |
catcgcttggatgttgtggtggtagtgatggttaaaccatcggttatgggaggggatgagttgggttctggaacagggtcgtgtttgttttgggtggaaa |
55477372 |
T |
 |
| Q |
195 |
ggaggtgaaggggaaggatgacgccgttaaggaagagttgatcggcgggaatgatgttgggttgtgggaaagaggggtttcttagcatccagaattcaaa |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55477373 |
ggagatgaaggggaaggatgacgccgttaaggaagagttgatcggcgggaatgatgttgggttgtgggaaagaagggtttcttagcatccagaattcaaa |
55477472 |
T |
 |
| Q |
295 |
ttctggtgaactgcattcattgttgcattttcttcttgaagttgatgat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55477473 |
ttctggtgaactgcattcattgttgcattttcttcttgaagttgatgat |
55477521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University