View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_high_27 (Length: 276)
Name: NF13672_high_27
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 23 - 257
Target Start/End: Complemental strand, 11102794 - 11102560
Alignment:
| Q |
23 |
cacagatacgtacaaagtttggaatgtagaaattaatataaaattattttttattagattacgtgtgacacaaaatatacatgttggtcttatatacttt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11102794 |
cacagatacgtacaaagtttggaatgtagaaattaatataaaattattttttattagattacgtgtgacacaaaatataaatgttggtcttatatacttt |
11102695 |
T |
 |
| Q |
123 |
acagttgacatgaatgggaatgtaaccgtttcagttgtgaataatgccaaatgaaagaatcaacaaaatgctcaaggtaaggaaatgcattgcggtgtaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
11102694 |
acagttgacatgaatgggaatgtaaccgtttcagttgtgaataatgccaaatgaaagaatcaacaaaatgctcaaggtaagggaatgcattgcagtgtaa |
11102595 |
T |
 |
| Q |
223 |
ttacgagcattattttgccgtatcatgtcatttgc |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11102594 |
ttacgagcattattttgccgtattatgtcatttgc |
11102560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University