View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_high_32 (Length: 238)
Name: NF13672_high_32
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1179403 - 1179172
Alignment:
| Q |
1 |
gttttgtctccacaacattctgattcaggtatatcttttccaccggagggatattccgaggcggaggctcctgctccggcaccggtgggtctggaagcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179403 |
gttttgtctccacaacattctgattcaggtatatcttttccaccggagggatattccgaggcggaggctcctgctccggcaccggtgggtctggaagcgg |
1179304 |
T |
|
| Q |
101 |
tggtgcagaagaagaa------tagaagagtttcgttgatggaaatgtccgagaaatcagaagcgttggatggagtgagaaagtgtgaaagtgtagccgt |
194 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179303 |
tggtgcagaagaagaagaagaatagaagagtttcgttgatggaaatgtccgagaaatcagaagcgttggatggagtgagaaagtgtgaaagtgtagccgt |
1179204 |
T |
|
| Q |
195 |
tggattgaaagagcacataagtgatattgatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1179203 |
tggattgaaagagcacataagtgatattgatg |
1179172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University