View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_19 (Length: 407)
Name: NF13672_low_19
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 11 - 391
Target Start/End: Original strand, 34327642 - 34328022
Alignment:
| Q |
11 |
cacagatagttggttggatgagacaattggtttgaaggaatgtagagtgaagtgtttggataattgttcttgtatggcatatgaaaatttagatgtaaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34327642 |
cacagatagttggttggatgagacaattggtttgaaggaatgtagagtgaagtgtttggataattgttcttgtatggcatatgcaaatttagatgtaaga |
34327741 |
T |
|
| Q |
111 |
gaagggagtggatgtgccttgtggtttggtgatttaattgatattagacggtttgagcttagcttatgatatgttatattaatcattgaatatttgtgtc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34327742 |
gaagggagtggatgtgccttgtggtttggtgatttaattgatattagacagtttgagcttagcttatgatatcttatattaatcattgaatatttgtgtc |
34327841 |
T |
|
| Q |
211 |
ccctgtatgagattttgatctaactatggttttctgtttggttaaattcacttagaaaatgccaatgaggtccacaagaagaaaatagtcttggtgggag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||| ||| |||||||||| |
|
|
| T |
34327842 |
ccctgtatgagattttgatctaactatggttttctgtttggtgaaattcacttaggaaatgccaatgagggtcacaagaagaaaggagttttggtgggag |
34327941 |
T |
|
| Q |
311 |
taacagtttctcttgccacggcagcggtttccggtatacttatagacagaaatcacaaaccaatgtaaaaggtgtagtttc |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34327942 |
aaacagtttctcttgccacggcagcggtttccggtatacttatagacagaaatcacaaaccaatgtaaaaggtgtagtttc |
34328022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 23562052 - 23562004
Alignment:
| Q |
109 |
gagaagggagtggatgtgccttgtggtttggtgatttaattgatattag |
157 |
Q |
| |
|
||||||| ||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
23562052 |
gagaaggcagtggctgtgtcatgtggtttggtgatttaattgatattag |
23562004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University