View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_22 (Length: 363)
Name: NF13672_low_22
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 16 - 363
Target Start/End: Original strand, 39249704 - 39250054
Alignment:
| Q |
16 |
atgttttggttggtatgaatgtaggtttgaataatgttaaagcacgttctaggattaacacgtggcataatgttttctttgccatgcaaaaagctacaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39249704 |
atgttttggttggtatgaatgtaggtttgaataatgttaaagcacgttctaggattaacacgtggcataatgttttctttgccatgcaaaaagctacaca |
39249803 |
T |
 |
| Q |
116 |
agatttgatttaagaaaaatgtcttgtaaaccaagtattatctgcacgcgtttatccgagtcttgtaggatccagatggtcggaaaatttgactcacaat |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| || |
|
|
| T |
39249804 |
agatttgatttaagaaaaatgtgttgtaaaccaagtattat-tgcacacgtttatccgagtcttgtaggattcagatggtcggaaaatttgaatcacgat |
39249902 |
T |
 |
| Q |
216 |
ttgatatgtttaattggtctttctcacgtgtggaggatgctaaggctagcttaattttcaccatttttatttctcctcatag----atatataacctttc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
39249903 |
ttgatatgtttaattggtctttctcacgtgtggaggatgctaaggctagcttaattttccctatttttatttctcctcatagatatatatataacctttc |
39250002 |
T |
 |
| Q |
312 |
ttgtattggttgggtcaatagattataatagggttggaggggtcaatttctt |
363 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39250003 |
ttgtattggctgggtcaatagattataatagggttggaggggtcaatttctt |
39250054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University