View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_23 (Length: 355)
Name: NF13672_low_23
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 310
Target Start/End: Original strand, 37199873 - 37200164
Alignment:
| Q |
19 |
tcttcaacagatagatatcttagtcttctcattttgggcattgtaggtgaagagtttttatcttatgcttgctagttatctacttggctgttgtaacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37199873 |
tcttcaacagatagatatcttagtcttctcattttgggcattgtaggtgaagagtttttatcttatgcttgctagttatctacttggctgttgtaacaaa |
37199972 |
T |
|
| Q |
119 |
acacagacggtatggtgagcattggttattgtaatcttgttatatcctatcgaaaacacaacttgcatattttggtcttgtaaaacttatcttgttacct |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37199973 |
acacagacgatatggtgagcattggttattgtaatcttgttatatcctgtcgaaaacacaacttgcatattttggtcttgtaaaacttaccttgttacct |
37200072 |
T |
|
| Q |
219 |
gcattcacatatccttcaatactgaaaagacatgatacatgtctaatgtaaatcaaggttgatacatatgtgcacatttatgcatacatatg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37200073 |
gcattcacatatccttcaatactgaaaagacatgatacatgtctaatgtaaatcaaggttgatacatatgtgcacatttatgcatacatatg |
37200164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 68 - 105
Target Start/End: Original strand, 37216268 - 37216305
Alignment:
| Q |
68 |
aagagtttttatcttatgcttgctagttatctacttgg |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37216268 |
aagagtttttagcttatgcttgctagttatctacttgg |
37216305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University