View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_31 (Length: 269)
Name: NF13672_low_31
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 27842960 - 27842881
Alignment:
| Q |
18 |
gaaactcatacactactacgatgtcccgagtttaaacttggataaagttgtccaacctaacaatattgatacattccgag |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27842960 |
gaaactcatacactactacgatgtcccgagtttaaacatggataaagttgtccaacctaacaatattgatacattccgag |
27842881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University