View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_33 (Length: 246)
Name: NF13672_low_33
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 852927 - 853152
Alignment:
| Q |
1 |
tatgccactgactaccagatcaggtgttgtaggaaatagtgctctggaaattccgagagaagtgcaatcagctggagtacctgcaaagaacgaaaaatag |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
852927 |
tatgccactgactaccagattaggtgttgtaggaaatagtgctctggaaattccgagagaagtgcaatcagctggagtacctgcaaagaaccaaaaatag |
853026 |
T |
|
| Q |
101 |
tcattgagacttgatcttgagcgggtaaaaatggaaatggaagaaagagtaaccagccaaccagaaaccgcgaaggaagcaacagttccatgaatgtcaa |
200 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
853027 |
tcgttgagacttgatcttgagcgtgtaaaaatggaaatggaag-aagagtaaccagccaaccagaaaccgcgaaggaagcaacggttccatgaatgtcaa |
853125 |
T |
|
| Q |
201 |
cttgtttgacagtaactgggtgaagcc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
853126 |
cttgtttgacagcaactgggtgaagcc |
853152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 47054053 - 47053998
Alignment:
| Q |
28 |
tgtaggaaatagtgctctggaaattccgagagaagtgcaatcagctggagtacctg |
83 |
Q |
| |
|
||||||||| |||||| |||||| ||| ||||||||||||||||||||||| |||| |
|
|
| T |
47054053 |
tgtaggaaagagtgctttggaaactcccagagaagtgcaatcagctggagttcctg |
47053998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University