View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_34 (Length: 243)
Name: NF13672_low_34
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 41860002 - 41859777
Alignment:
| Q |
1 |
tctatatttagggaggaaattacttaccaagatgaaaacgttgagatctttatctgagatgttgactgcatcttgattctcatttctttggaactcaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41860002 |
tctatatttagggaggaaattacttaccaagatgaaaacgttgagatctttatctgagatgttgactgcatcttgattctcatttctttggaactcaagc |
41859903 |
T |
|
| Q |
101 |
aagacatccaagaaatctcttgatttctcatcacgttccacttccaaatccaaacgctctttcacaaacgtggaagcaatttcaatagcttttcccatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41859902 |
aagacatccaagaaatctcttgatttctcatcacgttccacttccaaatccaaacgctctttcacaaacgtggaagcaatttcaatagcttttcccatat |
41859803 |
T |
|
| Q |
201 |
ccctgtccatttttctccttagacct |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41859802 |
ccctgtccatttttctccttagacct |
41859777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University