View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13672_low_40 (Length: 212)
Name: NF13672_low_40
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13672_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 39250201 - 39250021
Alignment:
| Q |
23 |
catccaactcataatagtctatgaatttattcaaaacnnnnnnnncttaataatctatgaagcacattgttttctcccatcatc----acccaaacaa-a |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| | | | ||| | |
|
|
| T |
39250201 |
catccaactcataataatctatgaatttattcaaaacaaaaaaa-ctta-taatctatgaagcacattgttttctcccatcacccaaaatctaaatttta |
39250104 |
T |
 |
| Q |
118 |
atctaaataaagttaaactattcttcatacaatttttcaagagaagaaaaagaaattgacccctccaaccctagtataatcta |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39250103 |
atctaaataaagttaaactattctttatacaatttttcaagagaagaaaaagaaattgacccctccaaccctattataatcta |
39250021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University