View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13675_high_21 (Length: 301)
Name: NF13675_high_21
Description: NF13675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13675_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 273
Target Start/End: Complemental strand, 10556137 - 10555880
Alignment:
| Q |
14 |
gataattcaccggtgatatatattaacctaactcataaggctactatgaacagatatatctaagagagaattaagcatcccgnnnnnnnctttctgtaaa |
113 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| | |||||| | ||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
10556137 |
gataattcaccggtgacatatattgacctaactccttaggctattttgaacagatatattt--gagagaattaagcatcccatttttttctttctgtaaa |
10556040 |
T |
 |
| Q |
114 |
attagattagatatagctgaatcggtatgggacacgtttgaaaaggatggatgagtttatgagcaaaatgggatgaaatcagacaagaaaaagacaacaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10556039 |
attagattagatatagctgaatcggtatgggacacatttgaaaaggatggatgagtttatgagcaaaatgggatgaaatcagacaagaaaaagacaacaa |
10555940 |
T |
 |
| Q |
214 |
catgaaagataagacgaggctctattaaattttgtgccctccttgggatgtgtggtcagt |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10555939 |
catgaaagataagaggaggctctattaaattttgtgccctccttgggatgtgtggtcagt |
10555880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University