View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13675_low_2 (Length: 245)
Name: NF13675_low_2
Description: NF13675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13675_low_2 |
 | |
|
| [»] scaffold0066 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 25 - 230
Target Start/End: Original strand, 7425460 - 7425666
Alignment:
| Q |
25 |
ggttcaggttctttcttggttatgccaactaggtgattggaggctcttgtattaaaattgtggcggacctttttaa-acctagctctttaagtcctaggg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7425460 |
ggttcaggttctttcttggttatgccaactaggtgattggaggctcttgtattaaaattgtggcggacctttttaacacctagctctttaagtcctaggg |
7425559 |
T |
|
| Q |
124 |
catgtctctgtaacatcacagattatttacgctgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtct |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425560 |
catttctctgtaacatcacagattatttatgctgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtct |
7425659 |
T |
|
| Q |
224 |
gtctgtg |
230 |
Q |
| |
|
||||||| |
|
|
| T |
7425660 |
gtctgtg |
7425666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 227
Target Start/End: Complemental strand, 18139 - 18068
Alignment:
| Q |
156 |
tgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtctgtct |
227 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||| || || |||||||||||||||||| |||||| ||||| |
|
|
| T |
18139 |
tgtgtctgaaatatccgaagttgcggcagtttggcagttttttgattcatagtctgaggagggggtgtgtct |
18068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University