View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13677_high_1 (Length: 429)
Name: NF13677_high_1
Description: NF13677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13677_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 4 - 209
Target Start/End: Complemental strand, 34901456 - 34901252
Alignment:
| Q |
4 |
gcaactcgtcatattcctactaatgtgtgtaaccagcttgacaaaatagctagaagcttttctttggggcggtgacgaggtatcaaggacttgaaaccat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34901456 |
gcaactcgtcatattcctactaatgtgtgtaaccagcttgacaaaatagctagaagcttt-ctttggggcggtgacggggtatcaaggacttgaaaccat |
34901358 |
T |
 |
| Q |
104 |
gttaattggcatacagttactaccttgaaacactttgagggccttggtatttgtgaagctagggtcctaaatgtgtctctttttggaaaacttgtgtgga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
34901357 |
gttaattggcatacagttactaccttgaaacactctgtgggccttggtatttgtgaagttaggatcataaatgtgtctctttttggaaaacttgtgtgga |
34901258 |
T |
 |
| Q |
204 |
atatgt |
209 |
Q |
| |
|
||||| |
|
|
| T |
34901257 |
gtatgt |
34901252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 334 - 409
Target Start/End: Complemental strand, 30091588 - 30091513
Alignment:
| Q |
334 |
ttcttttgcccatgggcataagttgcgtataggtgccggtgaaacttcattttggtatgagtattggaccaaacta |
409 |
Q |
| |
|
||||||||| | ||| ||||| ||| |||||| || |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30091588 |
ttcttttgctcctggttataaggtgcatataggggctggtgaaactttcttttggtatgagtattggaccaaacta |
30091513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University