View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1367_high_13 (Length: 243)
Name: NF1367_high_13
Description: NF1367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1367_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 48148338 - 48148514
Alignment:
| Q |
1 |
aaataaaacttccttagtgattatagaaacgagacatgacatgatatgatccctcatgaaacacaagcagcaggcaccagacacttggaaatgaaaccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48148338 |
aaataaaacttccttagtgattatagaaacgagacatgacatgatatgatccctcatgaaacacaagcagcaggcaccagacacttggaaatgaaaccca |
48148437 |
T |
 |
| Q |
101 |
acannnnnnnctgcacaaacattaaagtcaaagataacattaacaataatgaatgtatcaatttcaaatcacggata |
177 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48148438 |
acatttttttctgcacaaacattaaagtcaaagataacattaacaataatgaatgtatcaatttcaaatcacggata |
48148514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University