View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1367_low_16 (Length: 251)
Name: NF1367_low_16
Description: NF1367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1367_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 47 - 251
Target Start/End: Complemental strand, 9064377 - 9064178
Alignment:
| Q |
47 |
agagactaatgacaatttatttgatgccctacaagtcaagaactgaattgaaaacttatttaattcgcaacccatgaatcattattaaaaatttgggtta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9064377 |
agagactaatgacaatttatttgatgccctacaagtcaagaactgaattgaaaacttatttaattcgcaacccatgaatcattattaaaaatttgggtta |
9064278 |
T |
 |
| Q |
147 |
ctaannnnnnnngaagggaaggttactaatttttaatcaaggacatatttatttggttggagctaatttcggttcaccaagcatgtgaggattcagatcc |
246 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9064277 |
ctaagtttttttgaagggaaggttactaa-ttttaatcaaggaca----tatttggttggagctaatttcagttcaccaagcatgtgaggattcagatcc |
9064183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University